Microarray Probes on PGSC0003DMT400059186

Probe IDChipProbe Sequence
CUST_42446_PI426222305 JHI_St_60k_v1 ATGCATACTTCAAGTGGTTAAATGCCTGCTTTGCAAGGTTGAAGGCAAAACTGAGGGCCT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400059186

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400059186 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G34930.1 +1 8e-99 328 235/689 (34%) disease resistance family protein / LRR family protein | chr2:14737169-14739886 REVERSE LENGTH=905

Transcript Sequence (2256 bp)

>PGSC0003DMT400059186 2256 pgsc_dm_v3.4
ATGTCTAGTGGCTTTGGGTACTTGAAGTTTTTGGAACATGTTAAGCTATTTGGAAGTGGT
ATTCAAGGTGGGATACCAAGGTCTTTTGGGAGTTTAAGTCGTTTACGCTCTATTGATGCA
GATTCCAATAACTTGTTAAGTCAACCGTTTTCTGAGTTGCTTGATATCTTAGCTGGGAGT
AATCAATCGCTTGAGTATTTGTCGTTTGAGGGAAATGCATTCACTGGTTCATTGATTAAT
CTTACTAGATTTTCATCCTTGAGGGAATTGAGGCTACGAGAAAACTCTCTGAACGGCATT
TTCCATGAAAGCTTTAGAAAAATCTCCAATCTTGAGTATCTTGATTTGTCTAATAACCAA
ATGACAGGGTCATTACCAGACTTGGCATTCTTTCCATCATTGAGAGAGTTGCACTTACAG
TCCAATCACTTTTATGGAATGATACCACAAGGTTTAGGGAAACTTTCCGAGCTTAAAATC
TTGGATGTGTCTTTCAATAAATTGCAAGGCTTACCGGATAGTTTGGGGCAACTTTCCAAG
CTGAAAATATTGGATGTGTCTTTCAATAGACTGAAAGGCTTATCGGAAAGTTTAGGGCAA
CTTTTCGACCTTGAAAGTTTTGATGCTTCTAATAATTTATTAGAAGGTACAATCTCTGAA
TCCCATCTTTCCAACCTTTGCAACTTGAAGAGTTTAAAATTGTCTTCCAACTCGTTGACT
TGGAATGTTAGTGTTGATTGGATTCCATGTTTTCAACTCCAAGATATCAGTCTTTCGTCT
TGTAATCTTGGGCCTCTTTTTCCGAAATGGCTTCAAACTCAAAATAGCTACTCATTTCTT
AATATCTCTCTTGCTAGTATCTCAGACACAATGCCTATTTGGTTTACAAAGTTGCCTCCC
ATGTTATACTTTTTGAATCTCTCTTACAACCAAATCAGCGGGAAGATACAAGATTTATCA
GCCAATAATATCGGTTCCATTGTTATAGATCTTGGTTATAACAATTTTTCAGGACCCTTA
CCAACATTTCCTCATTTGGTTAGTGAATTGCGTGTTGACAACAATAAGTTTTCTGGATCA
CTTAACTCCATATGTAAAATTCATTCGCCTGTAACACTTGACTTGTCCGATATTCTCTTG
TCCGGAGAGATTCCTGATTGTTGGACCCTCATGTCTGTTCCAACGGTCCTTAATGTAGCC
AATAACCGTATATCTGGAAGCATTCCATACTCTTTGTGTTCTTCAACATCCTTGAACTCT
CTATACGTGCGTAACAACAATTTAAGTGGACAGTTTCCTGCCTCTTTGAAGAATTGCCAA
GGTTTGAAAGTCTTGGATTTGGGAAGAAATAGATTGAGTGGAAAAATCCCAGAATGGATA
GGGACTAAGTTGGCTGGTTTGGGCATTCTGAGCCTACGATTCAACGAATTTTCTGGTAGC
ATTCCTCCAAGTATATGCCAGCTTCAATCTATTCAGATACTGGACCTTTCTGGCAACCAT
TTATCCGGAAGAATTCCAAAATGCTTCAGCAATTTCACCACAATGCAACTTTTGCAAGAT
GGTTCAAGTGTGAGCTATGACTTCAATCCACTTGCCGGTAGAGGAATTTTAGTGTACAAA
GGCAATGCATTTGTTCAATGGAAAAACAAGGAATCAGAATACCGTAACACCTTGTGGCTT
CTGAAAACCATTGATCTTTCTAGCAACGAACTAGTTGGTGACATCCCTAAAGATTTTAGC
AGAATGAACGCATTGCTGTCATTGAACATATCAAGAAACAATTTGACAGGAAGTATCATT
GAAGGAATTGGTTTAATGAAGATGTTGGAGGCTCTTGACTTGTCCGGGAATCATCTCTCG
GGGAAGATCCCAGTAGGACTGGCTAACTTGACATTTCTTAGTGTGTTGGATTTGTCAAAA
AACAACTTGTCAGGGAGAATACCATCGAGCACTCAATTGCAAAGCTTTGATCCTTCAACC
TATGGTGGGAATATTCAGCTATGTGGACCTCCTCTTCCAGCATGTCCTACATTTTCTCCT
CCAAATCCTCATGTTGGCTTTGACAGTACTCGTCAAGAAAATGATGATGATGATGAGTTT
CCTTCTAAAGAGTTTTATGTATCGATGGCATTGGGCTTCATTGTCGCATTTTGGGGAATT
TTGGGCTCTTTGTACTTCAATGATTCATGGAGGAATGCATACTTCAAGTGGTTAAATGCC
TGCTTTGCAAGGTTGAAGGCAAAACTGAGGGCCTGA