Microarray Probes on PGSC0003DMT400059158

Probe IDChipProbe Sequence
CUST_42461_PI426222305 JHI_St_60k_v1 CTCCATCTTTAGCTCAAGGCCTGATTTATGTTATATGTAAATATCCTATGAATGGCTTGT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400059158

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400059158 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G34930.1 +3 7e-90 308 276/854 (32%) disease resistance family protein / LRR family protein | chr2:14737169-14739886 REVERSE LENGTH=905

Transcript Sequence (2711 bp)

>PGSC0003DMT400059158 2711 pgsc_dm_v3.4
CTTTCACTGGTCTTATTCCTCTTCAGTTCCAAAATCTAACACACTTAAAGACTCTTGATC
TTGGTCAAAATTCTTTAACAGTGAAAAGCCTTGAGTGGCTTTCTAATCTAGTGTATTTGG
AGTACTTAGATCTTCATTTTTCCAATGTGCAAGTGAAAAACTGGTTACAAGAGATGATTA
AGCTTCCTAATTTGAGGGAATTGCATTTATCAGCCTGTCAACTCCCTGTAATCATTCCTT
CATCACTTGTATCAGCCAATATTTCCTCGTCTCATCTTTCGATCCTTGACATCTCCTATA
ATAGATATTCGTCCCCTGCAATAAATAGTTGGTTATTTAACTTCACTAGTCTTACTAGCC
TAGATCTTTCGGGTAACGACTTAGGCCAAATGTCTAGTGGCTTTGGGTACTTGAAGTCTT
TGGAACATGTTAAGCTATTTGGAAGTGGTATTCAAGGTGGGATACCAAGGTCTTTTGGGA
GTTTAAGTCGTTTACGCTCTATTGATGCAGATTCCAATAACTTGTTAAGTCAACCATTTT
CTGAGTTGCTTGATAACTTAGCTGGGAGTAATCAATCGCTTGAATATCTGTCGTTTGAGG
GAAATGCACTCACTGGTTCATTGATTAATCTTACTAGATTTTCATCCTTGAGGGAGTTGA
GGCTACGAGAGAATTCGCTGAATGGCATTTTCCATGATAGCTTTAGACAAATCTCCTGTC
TTGAGTATCTTGATTTGTCTAATAACCAAATGACAGGGTCATTACCAGACTTGGAATTCT
TTCCATCACTGAGAGAGTTGAAATTACGGTCCAATCACTTTTATGGAATGATACCACAAG
GTTTAGGGAAACTTTCCGAGCTTAAAATCTTGGATGTGTCTTTCAACATATTGCAAGGCT
TACCAGATAGTTTGGGGCAACTTTCCAAGCTGAAAATCTTGGATGTGTCTTTCAATAGAC
TGAAAGGCTTACCGGAAAGTTTAGGGCAACTTTTCGACCTTGAAAGTTTTGATGCTCCTT
ATAATTTGTTAGAAGGTACAGTCTCTGAATCCCATCTTTCCAACCTTTGCAAATTGAAAA
GCTTAAACTTGTCTTCCAACTCCTTGACTTGGAATGTTAGCGTTGATTGGATTCCGTGTT
TTCAACTACAAGTTATCAGTCTTTCGTCTTGTAATCTTGGACCAAACTTTCCAAAATGGC
TTCAAACTCAAAATGACTACTCAATTCTGGATCTATCTCTTAATAGTCTCTCAGACACAA
TGCCTAGTTGGTTCTCAAAGTTGCCTCCCATGTTAACATACTTGAATCTCTCTTACAACC
AAATCATCGGAAAGATACAAGATTTATCAGCCAATAATATCGGTTCCATTGTTATAGATC
TTGGTTATAACAATTTTTCAGGACCCTTACCAACATTTCCTCAATTGGTTAGTGCATTGC
GTATTGACAACAATCAGATTTCTGGATCACTTAACTCCATATGCAAAATTCGTTCAGCTG
TAACACTTGACTTGTCCGATAATCTCTTGTCCGGAGAGATTCCTGATTGTTGGACCCTCA
TGTCTGTTCCAATGGTCCTTAACTTAGCCAATAACCATATATCTGGAAGCATTCCGTACT
CTCTGTGTTCTTCGACATCCTTGAGCTCTCTATACGTGCGTAACAACAATTTAAGCGGAC
AGTTTCCAGCCTCTTTGAAGAATTGCCAAGGTTTGAAAGTCTTGGATTTGGGAAGAAATA
CATTTAGTGGAAAAATCCCAGAATGGATAGGGACTGAGTTAGCTTATTTGGGGATTCTGA
GCCTTCGATTCAACGAATTCTCTGGGAGCATTCCTTTAAGTATATGTCAGCTTCAATCTA
TTCAGATACTGGACCTTTCTGGCAACCATTTATCAGGAAGAATTCCGAAATGCTTCAGCA
ATTTCAGCACAATGCAACTTTTGCAAGATGGTTCAAGTGTGAGCTATGACTTCGATCCTT
ACACCCCTCGAGTAGGTACATTGTACCATGGCAATGCACTAGTCCAATGGAAAAACAAAG
AGTCAGAGTATCGTAACATCTTGTGGCTTCTGAAAACCATCGATCTTTCTAGCAACGATC
TAGTCGGTGACATCCCTAAAGATTTTAGCAAAATGAATGCATTGCTGTCATTGAACCTAT
CAAGGAACAATTTGACTGGAAATATCGTTGAAGGAATTGGTTTAATGAAGATGTTAGAGT
CTCTTGACTTGTCGAGGAACCATCTCTCGGGGAAGATCCCAGTAGGGCTTGCTAACCTGA
CATTTCTTAGCGTGTTGGATTTGTCAAACAACAACTTGTCAGGGAGAATACCATCGAGCA
CTCAATTGCAAGGCTTCGACTCCTCAACCTATGGTGGGAATGTTCAGCTATGTGGCCCTC
CTCTTCCAGAGTGTCCTTCATTTGCTCCTCCAAATCTTCATGTTGGTCAAGACAGTAATT
TCCAAGAAAATGATGATGATGATGAGTTTCCATCAAAAGAGTTTTATATATCGATGGCGT
TAGGGTTCATTGTTGCATTTGGGGGGGTGTTAGGATCTTTGTTCCTCAACAGTTCATGGA
GGAATGCCTATATTAAGTGGCTCCATCTTTAGCTCAAGGCCTGATTTATGTTATATGTAA
ATATCCTATGAATGGCTTGTAATCAAGAGAACTTCTTTTATATCTGATATTATAACTTTT
TTTTAAATTCT