Microarray Probes on PGSC0003DMT400059155

Probe IDChipProbe Sequence
CUST_42441_PI426222305 JHI_St_60k_v1 GAGGGCCTGATAAATGTCAAGTTTCTGTGTACTTGTTTACTTTTTAAGAGTTAGCTTGTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400059155

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400059155 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G34930.1 +2 7e-67 210 138/381 (36%) disease resistance family protein / LRR family protein | chr2:14737169-14739886 REVERSE LENGTH=905

Transcript Sequence (2327 bp)

>PGSC0003DMT400059155 2327 pgsc_dm_v3.4
CTTGAACATCTTAATCTTGCTAATAACTTTTAAGATTAAAGGTGGGGTTCCCAGTTCTTT
CGAGAATTTGACCTGTTTACGTCATCTGGACATGTCTAATACTTAGACAGACCAATGGCT
TCCTGAGTTGTTTCTCAGGTTATCAGGCAGTAGGAAATCACTTGAGGTTTTGGGGTTGAA
CGACAACTCATTGTTTGGTTCAATTGTTAATATGACAAGATTTTCATCCTTGAAGAAATT
ATACCTGCAGAAGAATGTGCTGAATGGTTCTTTCATGGAAAGTGCGGGACAAGTTTCTAC
CCTCGAGTATCTGGATTTGTCTGATAACCAAATGAGAGGGGCATTACCAAATTTAACATT
GTTTCCATCATTGAGAGAGTTGCATCTTGGCTCTAATCAATTTTCAAGGGAGGATACCAC
AAGGTATCAGACAACTTTTACAGCTTAGAATTTTGGATGTCTCGTCCAATAGACTGGAAG
GATTACCAGAAAGTATGGGGCAACTATCTAATCTGGAAAGTTTTGATGCCTCTTACAATG
TCCTGAAGGGTACAATTACTGAGTCCCACCTTTCAAACCTCTCCAGTTTAGTGGATTTGG
ACTTGTCATTCAACTCATTGGCTCTGAAGACGAGCTTCGATTAGCTTCCTCCTTTCCAGC
TACAAGTTATAAGCCTGCCGTCTTGCAATTTGGGACCTTCTTTCCTAAAATGGCTTCAAA
ATCAACATAACTATACTGTTCTTGATATCTCTCTTGCAAGTATTTCAGACACGCTTCCAA
GTTGGTTCTCTGGCATTCCTCCCGATCTAAAGATTTTGAATCTCTCAAACAACCAAATCA
GTGGAAGAGTGGAAGAGTGTCTAACTTAATAGAGAATACATATGGTTACAAGGTTATAGA
TTTAAGCTCTAACAACTTTTCAGGGCCTTTGCCAATAGTCCCTACCAATGTCCAAATATT
TTACCTGCATAAAAATCAGTTTTTTGGATCCATCTCTGCAATTTGTCAAAGTAAAACATC
CCCCACTTCTCTCGACTTGGCACACAACCAATTCTCAGGAGAACTTCCAGATTGTTGGAT
GAACATGACAAGTCTAGCTGTTCTTAATCTAGCTTATAACAATTTCTCTGGAGAAATTCC
ACATTCATTGGGTTCCTTGACAAATTTGAAGGCGTTATACATACGCCAAAACAGTTTTAG
TGGAATGTTGCCTTCTTTTTCACAATGTCAGCAGTTGCAAATCTTGGATCTTGGAGGGAA
TACGTTGACAGGAAGTGTCCCGGCATGGATAGGGACTGATCTACTCAATTCGCGCATTCT
AAGCATGCGGTTCAACAGATTGCATGGCAGCATACCGTCCATAATCTGTCAGCTTCAATT
TCTTCAGATACTGGACCTTTTAACAAATGGATTATCAGGGAAAATTCCACATTGCTTCAA
CAATTTTACCTTATTGTATCAAGATAATAATTCTGGTAAGCCAATGGAATTTATAGTTCA
AGGTTTCTATCGTAAATTTCCTCGTCGTTACTTGTATATTGGTGACCTATTGGTTCAATG
GAAAAATCAGGAGGCTGAGTACAAAAATCCTTTATTATATCTGAAGACTATTGATCTTTC
AAGTAATGAATTGGTTGGAGGTGTTCCTGAAGAAATAGCTGAGATGAGAGGATTGAAATC
TTTGAATCTATCAAGAAATGATCTGAATGGAACTGTCGTTGAAAGAATAGGTCAAATGAA
GATGTTGGAGTCTCTTGACATGTCAAGAAACCAGCTTTCTGGTGTGATCCCCCAGGGTCT
TGCGAATTTGACTTTTCTTAGTGTGTTGGACTTGTCGAACAACCACTTATCCGGGAGAAT
TCCATCAAGCACTCAACTGCAAAGTTTTGATAGATCATCCTACAGTGATAATGTTCAACT
CTGTGGTCCTCCTCTTCAAGAGTGTCCCGGATATGCTCCTCCTAGCCCTCTTATCGATTA
TGGTAGCAACAACAATCCATAAGAACATGATGACGATGAAGAGGAGTTCCCATCGCTGGA
GTTTTATATATCAATGGTGCTAGGCTTTTTTGTTGCATTTTGGGGAATTTTGGGCTGTTT
AATTGTCAATAGTTCTTGGAGGAATGCCTACTTCACATTCTTAACGGACACGACAAGTTG
GCTCAATATGATATGAAGAGTCTGGTTTGCAAGACTCAAGAAAAAACAGAGGAGGGCCTG
ATAAATGTCAAGTTTCTGTGTACTTGTTTACTTTTTAAGAGTTAGCTTGTTTTCTTGTTC
TTCTTCCTACCTGATAGTTGCTTTCCTCTTGTTGTGATTTCTATCTG