Microarray Probes on PGSC0003DMT400058934

Probe IDChipProbe Sequence
CUST_9333_PI426222305 JHI_St_60k_v1 GGTGGACTAGTGAGTCTTCTCTGCATATATGTAATATCAAGATGTATGTTTGTATCTACA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400058934

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400058934 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G17420.1 +1 0.0 830 387/504 (77%) lipoxygenase 3 | chr1:5977512-5981384 FORWARD LENGTH=919

Transcript Sequence (1725 bp)

>PGSC0003DMT400058934 1725 pgsc_dm_v3.4
GTGGTGAATGCTTAATTAACAAATGTCAATATTGTGTACATTGCAGAGGACAAATTTGCC
TGGTTACGAGATGATGAATTTGCTCGACAAGCAATAGCAGGAGTGAACCCGGTATCCATC
GAAAAACTTCAGGTTTTTCCACCAGTAAGCAAGCTTAATCCTGAAATCTATGGCCCTCAA
GAATCCGCCCTCAAGGAGGCGCACATTCTTGGTCATCTAAATGGCATGACTGTTCAAGAG
GCTTTGGATGCAAATAAGCTTTTCATTGTGGATCATCATGATGTATACCTTCCATTTCTC
GATCGGATTAATGCACTTGATGGCCGCAAAGCATATGCAACACGCACCATTTTTTTCTTG
TCTGATGTTGGCACCCTTAAGCCCATTGCCATTGAACTTAGCCTCCCCCAAACTGGTCCA
AGTTCGCGATCCAAACGTGTTGTCACACCACCTGTTTGTGCCACTGGTAACTGGACGTGG
CAGATCGCTAAAGCACACGTCTGTGCTAATGATGCTGGAGTTCACCAACTCGTCAACCAC
TGGTTGCGTACACATGCATGCTTGGAACCATTTATATTGGCAGCACATAGGCAATTAAGC
GCGATGCATCCGATTTATAAGCTTTTGGATCCACATATGAGATACACTCTAGAAATTAAC
GGCTTGGCTCGCCAGAGCTTGCTCAATGCTGATGGTGTCATCGAGGCTTGCTTTACTCCT
GGTCGCTACTGCATGGAGATCAGTGCTGCTGCCTACAAGAATTGGCGCTTCGATTTAGAA
GGCCTTCCAGCTGACCTCATCCGAAGAGGGATAGCAGTACCGGACTCAACACAACCTCAT
GGGCTGAAACTTCTAATTGAGGACTATCCTTATGCTGCAGATGGGCTTATGATATGGGGC
GCAATCGAGGGCTGGGTTCGTGATTACGTAAACCAGTACTACCCATCCTCGGCCCAAGTT
TGCAGTGACAGGGAGCTGCAAGCTTGGTATGCCGAGACTATTAATGTGGGCCACGTTGAG
CTCCGCAATGAGGATTGGTGGCCCACATTAGCTGCTCCAGAGGACCTCATTTCCATCCTC
ACCACCCTCATCTGGCTGGCTTCAGCGCAACACGCTGCACTGAATTTCGGGCAGTACCCT
TACGGTGGCTACGTCCCAAACCGGCCACCACTCATGCGTCGATTAATCCCTGACGAGAAC
GATCCCGAGTACGCGGTGTTCCTAGCTGATCCACAAAAATATTTCTTCTCAGCTTTACCA
AGTTTGTTACAAGCAACAAAGTTCATGGCCGTGGTTGACACATTATCGACACATTCCCCG
GACGAAGAATACTTGGGGGAAAGACATCAACCGTCTACTTGGACCGGAGATGCAGAGATT
GTTGAAGCGTTCTACAAATTTTCCGCGGAAATAGGGAGAATTGAGAAGGAGATAGATGAA
AGAAATGCCGATACGAAACTAAAAAATAGGTGTGGTGCTGGTGTGTTACCATATGAACTA
TTGGCACCAAGTTCAGGCCCTGGAGTAACATGTAGAGGTGTTCCAAATAGTGTATCAATA
TGAGTAATTATAAGTACATATATATAACCAATGTTTATAAAGTCCATAAATAGGGTGGAC
TAGTGAGTCTTCTCTGCATATATGTAATATCAAGATGTATGTTTGTATCTACAGCTAGAT
TTTTGTAAGAACATTAATTAAATTAAATAATTAGCTACTAATACT