Microarray Probes on PGSC0003DMT400058917

Probe IDChipProbe Sequence
CUST_9368_PI426222305 JHI_St_60k_v1 GCGGAATCTAAATTTGTGGCTATACCAAAACTTTTTTCCTAACAACTTCTGAGGTTGTTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400058917

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400058917 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G19180.1 +3 2e-22 97 92/284 (32%) jasmonate-zim-domain protein 1 | chr1:6622312-6623271 FORWARD LENGTH=253

Transcript Sequence (1404 bp)

>PGSC0003DMT400058917 1404 pgsc_dm_v3.4
GTAATTTCCTTTATCTACCCCACCTTTTCATCTCTATTCTCTACCATAACATTCACATGT
TCCTTCCTCTCTACTACATAACTTCTCTAGCTACCAGAAAATAGTCACAATTCTTCATTT
CTGTTTCTATCAATTTTGGAATTTTCTCGTCGGAAAATATGTCGAATTTGTGTGACGGCC
GCAGGAGGACTGGAGACGGCAAGGCGCCGGAGAGATCGAGTTTCGTACAGACTTGTAACT
TGTTGAGTCAGTTTATTAAAGGGAAAGCTACTATTAGAGATCTGAATCTCGGAATCGCCG
GCCAAACGGAAGCTGCAGGGAAAACTGAAACTGCAACTATGGATTTATTAACAGTCATGG
AAAAACCATCTATTGATCTAACTAAAGAAGAACACAAATCCGTAGATCTTGTTACAACAG
AGTCTTCTAGAGAGAAGGAGGCCGCTGTAAATGAGCCCAGCACGAGTAAAGAGGCACCAA
AGGAGCCTAAAGCAGCCCAATTGACTATGTTCTATGATGGTAAAGTGATTGTTTTTGATG
ATTTCCCAGCTGACAAAGCTAGAGCAGTGATGTTATTGGCTAGTAAAGGATGTCATCAGA
GTTCATTTGGGACTTTCCAGACTACAAACATCGACAAAATTAACACATGTACTACTGCCC
CTGCTTCTTTGACAAGTAACAGAACTGATTCTGTTGCACCACAGCAACAACACCTCCAGA
TTAAGCCAGACTCTAGCTCTGCTGCACCGCAACAGCACAAGCACAATCTGCCGCCACTCC
ATGTTTGTAGTAGTACAAAAACTGATCAGCTTAAGCGCGGATCAGTTTCATCTGCACCCT
TAGTAGAGCAGGAGCAACACAAGCAAATCCAGTCACAGGCTGCCGGAATTAGCAGCAGCT
CCGAGCTACCTATTGCAAGAAGATCTTCACTACATAGGTTTCTTGAGAAGAGGAAAGATA
GGTAAGCGGAATCTAAATTTGTGGCTATACCAAAACTTTTTTCCTAACAACTTCTGAGGT
TGTTTTGTTTAAAAGAATCTCACTTCTTTTTCCGTCTAATTCAGGGCAATTGTTAGAGCT
CCATACCAAGTTGTACATAACAATCCGTTGTTACCATCGTCTTCAAATACTAATGGTGAA
TCATCTTCCAAGGATAGCGAAGATCAGCTTGATCTCAATTTCAAGTTATAGCCAAAACTC
CACTCTCGCAGTTGGAATTCCATAAGCTTTTTTTTGGTTGACGACTGGATAAGCTAGTAG
TATTAAATATATATTTAGATCAGTGATTTGAAGATTATTTTTCCAGCACAGCTTAGCTTA
CAGATTATATTTCTTGTATTAGATATTGTTTATTATTACCAACCGAATGTTATGACTCTT
TGATTTGTTAAAATAGAATGCGTA