Microarray Probes on PGSC0003DMT400058897

Probe IDChipProbe Sequence
CUST_9196_PI426222305 JHI_St_60k_v1 GATCCTCCTCTGGAAACTTCATGACGTGTATAGACAAATTTGGTTGATATTTGAAAAATC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400058897

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400058897 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G54100.1 +1 0.0 660 358/409 (88%) aldehyde dehydrogenase 7B4 | chr1:20195435-20198853 REVERSE LENGTH=508

Transcript Sequence (1722 bp)

>PGSC0003DMT400058897 1722 pgsc_dm_v3.4
CGACTTGTTTCACTTGAAATGGGAAAGATACTCCCAGAAGGAATTGGGGAGGTTCAAGAA
GTCATTGATATGTGTGATTTTGCTGTGGGATTGAGTCGACAACTGAATGGATCCGTTATT
CCTTCTGAACGTCCTAACCACATGATGTTGGAGATGTGGAATCCTCTCGGGATAGTTGGT
GTAATCACGGCTTTCAACTTCCCATGTGCTGTACTTGGATGGAATGCATGTATCGCACTG
GTCTGTGGCAATTGTGTTGTCTGGAAAGGTGCTCCAACAACACCATTGGTTACCATTGCG
ATGACAAAAATTGTGGCTAGTGTATTGGAGAAAAACAATTTACCTGGTTCAATTTTTACT
GCCTTCTGCGGTGGAGCTGATGTTGGTCAAGCAATAGCAAAGGACACACGAATTCCTCTA
GTTTCATTCACTGGGAGTTCAAAGGTTGGTCTTGCAGTTCAGCAAACAGTAAGTCAGAGA
TTTGGAAAATGTCTATTAGAATTAAGTGGAAATAATGCCATCATAATAATGGATGATGCG
GACATTAAACTTGCTGTTCGCTCTGTTTTATTTGCTGCTGTTGGTACGGCTGGTCAGCGC
TGTACAACATGCCGGAGACTGCTTGTGCACGAATCAATATATGAGAAGGTACTTGAACCA
CTAGTTGATGTTTACAAGCAAGTTAAGATAGGGGATCCTTTAGAAAAAGGTACCTTACTT
GGGCCATTGCATACTTGTACTTCTAGGGAAAATTTCGAGAAGGGAATCCACAATATCAAG
TCCCAGGGTGGAAAGATCCTTACAGGTGGTTCAGTCGTAGAATCTGAGGGTAATTTTGTG
CATCCAACAATTGTTGAAATTTCTTCAAAAGCTGAAATTGTGAAGGAAGAATTGTTTGCT
CCAGTTCTGTATGTAATGAAGTTTAAGACTTTCGAAGAAGCAGTTGAAATCAACAACTCT
GTCCCTCAAGGTTTAAGTAGTTCCATCTTCACCCGAAATCCAGAAAATATATTTAAGTGG
ATTGGACCTCAAGGAAGTGATTGTGGCATCGTCAATGTGAATATCCCAACAAATGGAGCT
GAAATTGGCGGTGCTTTTGGAGGTGAGAAAGGTACTGGTGGTGGCCGTGAGGCAGGAAGT
GATTCTTGGAAACAATATATGAGACGCTCAACTTGTACAATCAACTATGGGAGTGAATTA
CCATTGGCTCAAGGAATCAATTTTGGCTAGTTGAAATTGGTGCAGATACGCCCGTTTCGC
TCGTGAATTCATCCTGTAAGGTGCTTATGATTGCCCCGGAATCACTTAAATAATGTACCT
TCCTTGCAACTCAATTAAAATAATGTATTCTGAATCTAGTGTTCTCAGTGATCAGTACCA
GGTTGCCTAATCAATGAGTTTACTTGGCCGTTCTACTTTATTTGAAGAGTTGCTAACCTA
ATCTCTCATAACTAAAACAGAACACTTGCATTATTGGCACTAATAGTCAACTACCTAATC
ACCTAATCTTATGTAAACCACTAGTAGGTTTATGTTAGTCAATCATTGTGATATGTTACA
TCCAATAATGCAAATGATTATATTGTCCACATAAGGTCCTCGAGATCCTCCTCTGGAAAC
TTCATGACGTGTATAGACAAATTTGGTTGATATTTGAAAAATCAAACTGGTAAGTTGTAG
AAAAAAAAAACTGGTAGTTGTAAAAGTTGGAATATATCGGCG