Microarray Probes on PGSC0003DMT400058685

Probe IDChipProbe Sequence
CUST_44938_PI426222305 JHI_St_60k_v1 GCTGAAGGCCACACAGGAATGCTGATATATTCTTTATATATATTAATGCTGCTAACTTCA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400058685

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400058685 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G14820.3 +2 2e-65 218 107/162 (66%) Sec14p-like phosphatidylinositol transfer family protein | chr1:5105237-5106793 REVERSE LENGTH=252

Transcript Sequence (1832 bp)

>PGSC0003DMT400058685 1832 pgsc_dm_v3.4
CCTCATGTTTCGGCCATTAATATCTACTTCTTTGATTTGACACAATCTTTTGAGTTTTCT
AACTTTTTCTCTGTGTCTTTCTTCCCCCAAAACATTGAACTTTATACTTTTCAGAAAAAA
AAAATCAGAGTGAAATTTTTCTTCTCCTTCCACAAAAACCACTTTTTAAGTTGGGAAAAA
AACCTGAAAAATGGACAGAAATCAAGAAATTGCATTGACCCAAATGAGGAAATCAGTTGA
AAAGCTTGGATCTTCCACTGAAAGTTATGGTGAGAAGACATTAATGAGGTTCTTGATTGC
GAGATCAATGGACCCAGAGAAAGCTGCAAAGATGTTTTGTCAGTGGAAAAAATGGAGGGC
TGAGATGGTTCCACTTGGTTACATCTCTGATTCTGAAGTTGCAAATGAATTAGCAGCTGA
AAAACTTTATTTGCAGGGATTGTCCAAGAGTGGACACCCTATTGTGATAGTCAAAGTTAA
CAAGCATTTTCCTTCCAAAGATCAAGTTCAATTCAAGAAATTCGTCATTCATCTACTAGA
CAAAACAATTGCAAGTTCATTCAAAGGTAGGGAAATAGGAAATGAGAAACTTATTGCAAT
TCTTGATCTCAAGAATATTACCTATAGCAATGTTGATACTCGTGGATTGATAACTGGTTT
TCAGTTTTTACAGGTAACCCATTTGCCGTTCTATAGTATGCAAACCATTAGTACTGAGAC
ACACATAGCCAGTGTTATGAAAAGATACATAAATCTTGTACCATGGACAACGTTATACGT
CTCTTGTCAGCTATAAGACAAGAGTCGAGATTAACGGCTTAGTAGAACAACTCACTAGAC
TCTTTACGTAGGCCGTAGCTGGTATTGAACTCTCACATTTGAGCTATAGTTAAGGCTTTG
GTTTGCTTTCACTATGAGACAATGTTGCTCGGACTCTTCAAACATATTGCCGGGTGTGTG
TCTGATCCTCCAAGCGCTATGCATTTTTGGAGGATCCGACATGGTTGCGGCAACATTTTT
GGAGGGTCTGAGCAACATAGCCATGAGGTGTCCCCTTGATGTAATGAAATAATTTGAATA
TGCTCCACTAACTTAAAACCTCCGAATATTTTGGTCAAAATTGTTTCTCCTCTTAAGCTC
TTGTATCTTGATTTAGACAAATTAGGACCAATCTATATTGCTCAGACTTTCTAAAAATGT
TGTCGTATCCGCAGCAGACCCTCCAAAAATGCACTACTTTTGGAGTATCTGAAGCGCACC
CGATGACATTTTTGAAGAGTCCAAGCAATGTACTGAACAAATTGCTGAAGGCCACACAGG
AATGCTGATATATTCTTTATATATATTAATGCTGCTAACTTCATCTCATCTCACACAGTT
TCTTTCTACAGGCATACTACCCTGAGCGCTTAGCGGCTTGTTACCTTTTACACATGCCAC
AATTCTTTGTCACCATATGGCGATTTATTTGTCGCTTCCTTGAAAAGGCAACTCAAGAGA
AGATGAGGATTGTTACAAGTGAAGAAGAAAAGGAAGAGTTCATCCGAGAGGTCGGTGAAG
ATGTCTTACCGGAGGAGTATGGAGGGCGCGCTAAACTTGTACTTATGCAGGATGTTGCTG
TGAGCTACTAACACAAAGTAGAGGAATCTATAAATGTGAAACAAGATGAAAAAGAATAGC
TTCATAGAGATACTATTTATGTTACTAAAAAAGCTTTACTTATTTAACCTTAAGTCATAT
ACTAGATGGGCTATGGCCCGTACTGAGCACGGGTCCAACATATTTAATTTTGGAAAAATT
ATATAATTAGACATACTTCACTACTATATATA