Microarray Probes on PGSC0003DMT400058477

Probe IDChipProbe Sequence
CUST_42881_PI426222305 JHI_St_60k_v1 GGAGATTGTAATCTTTTCTAATTTGCCCTTTCTTGAGGATGTTAGGGTGGTGACTTTTTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400058477

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400058477 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G50420.1 +3 0.0 585 313/483 (65%) scarecrow-like 3 | chr1:18678177-18679625 REVERSE LENGTH=482

Transcript Sequence (2451 bp)

>PGSC0003DMT400058477 2451 pgsc_dm_v3.4
CAAAACGCCAAAAACAAAAATATTACCGACAAAAATTAACCCCATGCTTTGTCAACAACA
AAACAAGACTATGATCTCTCACAAACACACCTTTTTAATTCAAACCAATTCATCTCTCCC
TATATCTTCATTTCCAAAAAAAAAATAGGTTAAGAACCCAGAAAAATCTTGAACCCAGCA
AGAACTTTTATTTATTTATTTGGGAAAGTTCTTGTTATGATTTCTGTGGGTATTTGATGA
ATTGAATAACCCAGAAAGGAATTTCTAGTTCTTTGTCTTGTTGGTGAGTTCTTGCCAAAT
TTGTGCTTTTTGAGTACTTGTGCTCTGTTTTCTGGTGATTCTTGAACTTTGTTCTAAGAA
CTTATTTTGGGAGTTCTTGGTTTGATTTTTATGGGTTTTTGATGAATTGAGTTGCCCAGA
AAGGAATTCCTGGTTCTTTGTGTTGTTTGTGAGTTTTTGCCAAATTTGTGTTTTTTGGGT
ACTTATGCTCTGTTTTTTTCTTCTTCCTGAACTGGTGATTCTTGAACTTACTTTGGGAGT
TCTTGTGTTGCTTTTTGTGGGTTTTTGATGAATTGAGTTACCCAGAAAGGAATTCTTGGT
TCTTTGTGTTGTTTATAAGTTCTTGCCAAATTTGTCATTTTGGGAACTTGTGCTCTGTTT
TTTACTCATTCTTGCCAAAAATTTGTCTTTTTTTATGTTTCTTGGCATTTGTGTCACCAA
GTTTTGATTTTTTGGGAAATTTTTGGGTTTTGATTTCAAGAATCACAATGTTACAAGATG
ATGGTTCATCATCAGTGACTTCATCATCACCACTTCAAAATTTCCCAATGATGTCACTTT
CACCTAATTTTGGTGGCTCACCATATCAATGGCTTAAAGATTTGAAATCTGAGGATAGAG
GTTTATATCTAATTCACCTTTTGCTTACTTGTGCTAATCATGTAGCTATTGGAAATCTTG
AAAATGCTAACATAGCACTTGATCAAATTTCCCATCTTGCATCTCCTAATGGAGATACAA
TGCAGCGAATCGCCTCGTATTTCGCTGAATCACTTGCTGATAGGATTTTGAGATCTTGGA
ATGGGATTTACAAGGCGTTAAATTCGACAAAGTTGAGGGTTGTATCTGAGGATATTCTTG
TGAAGAAGATGTTTTTTGAGTACTTTCCGTTCTTGAAAGTAGCTTCTGTGATCGCTAATC
AAGCGATCATAGAAGCTATGGAAGGTGAAAAAATGGTTCATATAGTTGATCTTAATGCTT
CCGAACCCTTGCAGTGGCGTGCGCTCCTCCAGGATTTGAGCGCACGCCCTGAAGGACCCC
CGCATTTGAGGATTACGGGGGTCCATCAACAAAAGCAAGTGTTGGAACAAATAGCACATG
TTCTAACAGAAGAAGCTGAAAAGCTTGATATCCCTTTTCAGTTTCATCAAGTAGTTAGTA
AATTGGAGAATCTTGATATCGAAAAACTACGAGTTAAAACCGGAGAGGCGTTAGCTATTA
GTTCAGTTATGCAATTGCATACTCTTCTTGCACATGATGATGAACCCCAAAAGAAATCCC
CTTTGGGTTTTAAGCATTTGAATGGACTTCACTTGCAAAGGGCAATACTAAACCAAAACA
CTTTAGGGGATTTGCTCGAAAAAGAGACGACTACTAATGTTTTTAGTCCAGGCAATGAAT
CAGCATCCTCATCTCCGCTATCTTCAACTGCATCAACGAAGATGGATGGATTCCTCCACG
CATTGTGGGGGTTGTCACCAAAGGTCATGGTGGTTACAGAACAAGACTCGAATCATAACG
GTACAACCCTTATGGAAAGGCTATCCGAGTCGTTGTATTTTTATGCTGCATTGTTTGATT
GTCTCGAATTCACACTACAGAGAACATCGTTAGAGAGGTTAAAGGTTGAGAAAATGCTGT
TTGGAGAGGAGATTAAGAACATTGTAGCGTGTGAGGGAGGTGAACGGAAGGAGAGACACG
AAAAGTTGGATAAATGGTTTCAAAGATTCGATGGAGCTGGTTTCGCGAACGTGCCTTTGA
GTTATTACGCTATGTTGCAGGCAAGGAGATTGTTGCAGAGTTATAGTTGTGAAGGATACA
AGATTAAAGAGGAGAACGGTAGCGTGGTGATCTGCTGGCATGATCGCGCGCTTTTCGCAG
TTTCAGCTTGGAGATGTAGGAGGTGAAAACTTAGACAAGTTTACAATTAACAAAAGTTGA
ACTCCGAAAAACACGTTTGGTTCATCTTCCTATTTTCCTTTTGTAATGCACTTTGTAGGA
AGGTACTTTTTGTGAAGTGAAAACTCAACTCTCATGGAGATTGTAATCTTTTCTAATTTG
CCCTTTCTTGAGGATGTTAGGGTGGTGACTTTTTTTTCATTTTTTTATATAAAGTTCATA
ATTTTATGTATGATTTTAGTTCCATAAGAAGACCTAAAGAATTACTCAAAT