Microarray Probes on PGSC0003DMT400058117

Probe IDChipProbe Sequence
CUST_9119_PI426222305 JHI_St_60k_v1 TTCTTGACAAGCTTGATAATCACTATTTTAGCAGCAGTTTGGGATATGAAGCAGTTGCAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400058117

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400058117 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G36010.1 +1 2e-40 139 58/73 (79%) Pathogenesis-related thaumatin superfamily protein | chr4:17039472-17040976 REVERSE LENGTH=301

Transcript Sequence (387 bp)

>PGSC0003DMT400058117 387 pgsc_dm_v3.4
ATGATGAATAGCTTAAGTAGTGAGTGTGTGGGATGTAAGAGCGCTTGTGAAGCGTTTGGT
GATCCAAAATATTGTTGTAGTGGATCATACGCGTCTCCTGATACCTGTAAACCAACGGAG
TACTCATCGTTCTTCAAGAGGGCATGTCCGCGATCTTATAGCTATGCTTATGATGATGGC
ACCAGTACCTTTACTTGTGGTTCTGCAGATTATGTTATCACCTTTTGCCCTGTTCCTTCT
GATAGCCCTAAATCACCTGGAGGAGGTGCTGGCGACGGATCGTCGGCCACGAGCCGCGGC
GTATTAACCAATAGTCTATCACCATTCTTGACAAGCTTGATAATCACTATTTTAGCAGCA
GTTTGGGATATGAAGCAGTTGCATTGA