Microarray Probes on PGSC0003DMT400057687

Probe IDChipProbe Sequence
CUST_16013_PI426222305 JHI_St_60k_v1 GTCTCCCAATAATTGAAGGTTTGATTGAGAAGCATATTTGGTGTGCTACTTTTTGTGTTA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400057687

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400057687 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G05150.1 +2 6e-76 250 147/247 (60%) Octicosapeptide/Phox/Bem1p family protein | chr4:2660339-2662675 FORWARD LENGTH=477

Transcript Sequence (1541 bp)

>PGSC0003DMT400057687 1541 pgsc_dm_v3.4
ATTTCTGTTAACACTCCAAATACACCTTCAATGTAACAGGGACCAGTAACACTACTTAAC
AAACAGACTAACAGTCTCTTTCATTTTCACTTGCAGAGCGATGAGTGGGTCTATTCACGC
GCCGCCAGAGTTCGACTCCGGCAACGGCGATTCAGTAGCCTCTACGCCTCGCTCGGAGCA
CCACCACCACATGTATGATGACACCAGCGCTACACAGCCACGTGCCCGTTTCATGTGCAG
CTTCGGTGGCAAAATTATGCTCAGGCCACACGACAATCAACTCCGTTACGTCGGCGGCGA
TACTCGAATTGTTGCGGTGAACCGCCACACTACCTTCGCAGCTCTCCTCGGGAAACTCTC
CAAACTCGTCGGATATCCAAACATTAACATCAAGTACCAGCTCCCTAACGAGGAACTGGA
CGCTTTGATAACCGTCACAACCGATGAAGATTTGGAGAATATGATGGAAGAGTACGATCG
GCTCACGCAGAATCAGAAATCAGCTCGGCTTCGGCTCTTCCTTTTCCCTAACGATTCTGG
TTCCAGAGCCAGCACTATCAGCTCCATCCTCGACGGCTCATCTAAGCGAGAGCAATGGTT
TGTTGACGCTCTCAATGGTGGCGCCGGTCCGGGTCTGGAGCGTGGGCGATCCGAAGTATC
GTCTATTGTTTCTGAAGTTCCGGATTACTTGTTCGGGCTGGACAATTCCGATGATCCGCC
CCGCGAATCAAAATTCGTGAAGAACAAGATCCTTTCGGAGCCGGGCTCACCCGCTCCACC
CATTGTTTCTTCTCCTTATTGCTCTATTTCGTCATCATCAATGACACCTACAGCAGCTAT
GACAGTGATGCCGGATCTTCCACCTGTTAAAACAAAGCTCGATAAGCCAAACATGACAAC
TGAATCCAGAGAAACGCCTGTTGCGAGTGCGATTGAGACCGGCGAAAAGGCGGTTCAACA
GCAACAACCGAGTTATCCAAGTAGTCCACTATGGCATTACCCAGCACCACCGGTGCAAAC
CATACCCGTTTACTATGTCCCGGGTCCGGTTCAGCCCGGAAATATCCCGGTTCAATTACG
GGCTCCATATATTCATCCTTTTCCAGTTCCTCCGAATCAATTACCCGTCGGGTATCCACC
CGTTTCAAGTATGGGCCAAGTATACAGTGGATTGAGGCCGGTAATGAGTGTTGACCCGAA
TGAATTTTCTGCTACTGCAAGGGTTGTTACCGAAGGAATGAATTACTATGCAGTTAGGAA
TTCAGGAGTTGTTCCGGGTTATGGAGGTCCAGTTAGTGAAGAAATGCAGGGACCCGGAGG
TGATGGAAAATCGGGTCGGGTCTCCCAATAATTGAAGGTTTGATTGAGAAGCATATTTGG
TGTGCTACTTTTTGTGTTAAGCATTTTGTTTTAATTTGAAGCAAAGTTTTGTGAATGGTA
AATAAGTTGTAGTAATTGATAATCTATCCTCCAATTTTAATATGTGAGTATTTTATTAGT
AAAAAAGCAAGTTGTAAAAGCATTTAAGCAAAGTAACTTTC