Microarray Probes on PGSC0003DMT400057442

Probe IDChipProbe Sequence
CUST_15305_PI426222305 JHI_St_60k_v1 GATCAACTTTTGGTTGAATTGAGAAGGTTTCTGTTATTGCTTGTGCTATTGTTTAGAGTG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400057442

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400057442 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G20300.1 +1 2e-179 524 290/418 (69%) Protein of unknown function (DUF3537) | chr3:7079832-7081809 REVERSE LENGTH=452

Transcript Sequence (2166 bp)

>PGSC0003DMT400057442 2166 pgsc_dm_v3.4
AAAAAATTCTAACTCCGCCGCGGCGATCGTAAGCAAGTTAAAATCCCCCAAACAAAACAA
CTAGTGCAAACATGATCTTCAGTCTCAGCTGTACTAGGTATTTTTCACAATCAACATTAC
CCCACCACATGTATATAAACCTTTCTCTTCCAATAATCAAACTCCATTAAACCTCACCAG
ATCCACAAATCCCGGCACTCCACAATAATCTCTCTCCATTTTCATCAAACAAAAACTAAT
TTTTCTGCAATTTCATCAAACACCCAGAAAAAAAAAATCATTTTTTTCTCCATTTTCATC
AAATACCCAGTAAAAAGATTTAAGCTTTTTTCAATTTCATCAAACACCCAAAAAAAAAAA
AAAAAAAAATTAATCTTTTTCCATTTTTATCAAACACCCAGAAAAAAGATTGAAACTTTC
TCCATTTTCATCAAATACCCAGAAAAAAGATTTACACTTTCTGCAATTTCATCAAAAACC
CAGAAAAAAATTTGATCTTTTTCAATGGGGGATGAAAGTAAAGGCGAAAGCCAAAGCCAA
AGCCAATCTTTACTGAACAAGAAGAGTATATTATATGCACGTAGTACATCACATGCTTAC
GATGAATTGCATGTTTTTAGGAGATGGTTGAAGTGGATGTGTGTGGATCAATCTGATACA
TTATCTACTGTTCTGTCTTGGTTTGTTTTTATAATATTTGCAATTGTTGTTCCATGTTTG
TCCCATTTTCTATTGGCTTGTGCAGATTGTGATGCTAATCATGATAGACCTTATGACAAT
GTTGTTCAGTTGTCTCTTAGTGGTGTTGCTGCTCTGTCTTTTATTTGTCTTACTAGGTTT
ATGAAGAAATTTGGGCTTCGTAGGTTCTTGTTTCTTGATAAGCTTTGTGATGAAAGTGAG
ACTGTTAGAAAATGCTATATGGAAGAGCTCAATAGATCGTTGAAGATCCTATTCATATTT
GTCCTGCCATGTTTCGCTGCTGAAAGCATATATAAAATTTGGTGGTACAGTTCAGGTGGA
ACTCAAATCCCCTTTTTAGGCAATGTCATTGTGAGTGACATTGTCGCGTGCCTTCTGGAG
CTGAGCTCATGGCTTTACAGGACGACTGTGTTCTTCCTAGTGTGTGTCCTTTTTCGCTTG
ATTTGTTACCTTCAGATTCTCCGATTGAGAGATTTTTCTCAGATATTCCACATTGATTCT
GATGTTGAGACGGTGTTGAGAGAGCACCTTAGAATCAGGAGGCACTTGCGGATCATTAGC
CATAGGTACCGTAGATTTATCTTGTTGGGATTGGTATTTGTCACAGCAAGTCAATTTGCG
TCCCTTCTCATGACTACACGATCAACTGCTGATCTTCATATCTACAAGAGTGGTGAACTC
GCGCTATGCTCTCTGAGCCTTCTTGCCGGGCTGTTGATACTGTTGAGAGGTGCAGTCAGA
ATTACCCATAAGGCACAAGCTGTTACATGCTTGGCGGCTAAGTGGCACGTGTGTGCAACA
GTTGACTCTTTTGAAGCAGTTGAGGGTGAAACTCCTCCAATATCTCAAATAGCCAGCAAC
CAAGTTTTCCCTGTCACTTCCGAAGGGTCATCTGATGCTGATGATGTTGGAGATGAGGAA
GATGAGTTCGACAACACAAAATTTGTCCACTCATATGCATATAGCACAATTTCATTCCAG
AAAAGGCAGGCACTAGTGACATATTTTGAGCATAACAGAGCAGGAATTACTCTATATGGC
TTTATGCTGGATAGATCCTATCTTCACACTATTTTTGGTATGGAACTAGCACTGGTCCTC
TGGTTGCTTGGAAAAACTGTTGCTTCCATTGCTTGAATCATTGGGTATTGATTTGTTACG
TTCCTCGGACTCTCCAAAAATGATGCCGCACTCGTGTCAGATCCTTCAAAAACATACTAC
TTTAGAGGATTCGACACGCATCCTACGACATTTTCGAAGTGTTTGATCAACTTTTGGTTG
AATTGAGAAGGTTTCTGTTATTGCTTGTGCTATTGTTTAGAGTGTAACATATTACATATT
CAATCAGAAATTAAGATGCTTGTGTGGAATATGTGGGTGAATATGTATAGAGCTATTTTA
TTTATTCAATTTTGTATTATATTATACTGGATCTATAAGAGGTAAAATGATGTTATTTAC
TTGTTA