Microarray Probes on PGSC0003DMT400057441

Probe IDChipProbe Sequence
CUST_15091_PI426222305 JHI_St_60k_v1 GATCAACTTTTGGTTGAATTGAGAAGGTTTCTGTTATTGCTTGTGCTATTGTTTAGAGTG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400057441

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400057441 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G20300.1 +2 4e-117 353 211/300 (70%) Protein of unknown function (DUF3537) | chr3:7079832-7081809 REVERSE LENGTH=452

Transcript Sequence (1318 bp)

>PGSC0003DMT400057441 1318 pgsc_dm_v3.4
CTTTGTTGAAATTGGTAATTAGTGTGGAAATGTATATCGAACTGCATGATGTAATGTAAC
GATAATCCTTTTTTTCGATATGCAGAGATCGTTGAAGATCCTATTCATATTTGTCCTGCC
ATGTTTCGCTGCTGAAAGCATATATAAAATTTGGTGGTACAGTTCAGGTGGAACTCAAAT
CCCCTTTTTAGGCAATGTCATTGTGAGTGACATTGTCGCGTGCCTTCTGGAGCTGAGCTC
ATGGCTTTACAGGACGACTGTGTTCTTCCTAGTGTGTGTCCTTTTTCGCTTGATTTGTTA
CCTTCAGATTCTCCGATTGAGAGATTTTTCTCAGATATTCCACATTGATTCTGATGTTGA
GACGGTGTTGAGAGAGCACCTTAGAATCAGGAGGCACTTGCGGATCATTAGCCATAGGTA
CCGTAGATTTATCTTGTTGGGATTGGTATTTGTCACAGCAAGTCAATTTGCGTCCCTTCT
CATGACTACACGATCAACTGCTGATCTTCATATCTACAAGAGTGGTGAACTCGCGCTATG
CTCTCTGAGCCTTCTTGCCGGGCTGTTGATACTGTTGAGAGGTGCAGTCAGAATTACCCA
TAAGGCACAAGCTGTTACATGCTTGGCGGCTAAGTGGCACGTGTGTGCAACAGTTGACTC
TTTTGAAGCAGTTGAGGGTGAAACTCCTCCAATATCTCAAATAGCCAGCAACCAAGTTTT
CCCTGTCACTTCCGAAGGGTCATCTGATGCTGATGATGTTGGAGATGAGGAAGATGAGTT
CGACAACACAAAATTTGTCCACTCATATGCATATAGCACAATTTCATTCCAGAAAAGGCA
GGCACTAGTGACATATTTTGAGCATAACAGAGCAGGAATTACTCTATATGGCTTTATGCT
GGATAGATCCTATCTTCACACTATTTTTGGTATGGAACTAGCACTGGTCCTCTGGTTGCT
TGGAAAAACTGTTGCTTCCATTGCTTGAATCATTGGGTATTGATTTGTTACGTTCCTCGG
ACTCTCCAAAAATGATGCCGCACTCGTGTCAGATCCTTCAAAAACATACTACTTTAGAGG
ATTCGACACGCATCCTACGACATTTTCGAAGTGTTTGATCAACTTTTGGTTGAATTGAGA
AGGTTTCTGTTATTGCTTGTGCTATTGTTTAGAGTGTAACATATTACATATTCAATCAGA
AATTAAGATGCTTGTGTGGAATATGTGGGTGAATATGTATAGAGCTATTTTATTTATTCA
ATTTTGTATTATATTATACTGGATCTATAAGAGGTAAAATGATGTTATTTACTTGTTA