Microarray Probes on PGSC0003DMT400057399

Probe IDChipProbe Sequence
CUST_15307_PI426222305 JHI_St_60k_v1 CCTAGTTGTTCCAATATATGATGGTCTGATTCTAACGTGTTTGAGATTGAGACGGTGTAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400057399

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400057399 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G41761.1 +3 7e-22 88 41/76 (54%) unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G55570.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | chr5:16711437-16711742 FORWARD LENGTH=101

Transcript Sequence (632 bp)

>PGSC0003DMT400057399 632 pgsc_dm_v3.4
CTCTTTTCATTTTCATCTTCACCAGATAAAACTATTAATTGTATTTTCCAACAATGGCTT
TAAGTTGGGTTGTTACCATTGCAAACACAATTACTCTTGGAAACTCGAAATCACAATCAT
TGATCGAATTCAACAAAAATCAAACGAATCAGAGTATCATTTCCATTTCGAATGAAAAAT
ATTCCGAGTTTTTTCAAATGCCTCTTCATTATCCAAGATACACAAAACATGATTACGAGA
AGATGGAGGAATGGAAGATTGATACGCTTCTCAGAGAATATGGACTTAATTTTCAGGGGA
CTGTTGATGAGAAGAGGAGATTTGCTATAGGTGCATTTGTGTGGCCTGATCAACTTTGAT
TTTTGTCCTAATTTGGTTATATATGTTTTGATTTTGAGATTGAGACGGAGTTGTTGTTGT
TGTTATAGATGTTTGTGGCTAGTTTGAGTTTAAATTGTCCTAGTTGTTCCAATATATGAT
GGTCTGATTCTAACGTGTTTGAGATTGAGACGGTGTAATTGTTGTAATAGATGTTTTCAT
TTGTGGCTAAACAAGTTTAAATTTGTCCTAATAGGTCATGCATGCTCTGTTTTTTTCTTA
TATATTATAGCGGAATTTAACTTGCTTCAAAT