Microarray Probes on PGSC0003DMT400057320

Probe IDChipProbe Sequence
CUST_15002_PI426222305 JHI_St_60k_v1 CTAAGTCTCTCTTTTCCAGTTACTCAGAGTTTTTAACTTTAGAGAGCAGTGTCTGATTAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400057320

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400057320 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G55740.1 +1 0.0 1144 544/756 (72%) seed imbibition 1 | chr1:20835507-20838707 REVERSE LENGTH=754

Transcript Sequence (2658 bp)

>PGSC0003DMT400057320 2658 pgsc_dm_v3.4
CTTTTCTATTCTCCACTTTTCTCAGCTCCAATTTTTTTATACATTTTTTTCAATTACTAT
ACAAGTTTTGATCTCGTCATTGCTTATTCTTTGTGGGGTTTTTGAGATTTCTTGTTTTTT
TTGGTCTTAGAAAGATAAAGATCATATTATTTTTCATTTGGGTGTTTTCTTGTTTGGGTA
GTTTTGTTGGTTATAGAAAGAAAAAAGATGACAGTAGGAGCAGGAATTTGTGTAGCTGAA
AGGAAGCTTAATGTATTGGGGCAAAGCATTCTAACTGATGTTGATGAAAATATTATTGTT
AGTCAGCCAAATGGTGAAGCTTTCACTAATGGGGCATTTCTTGGTGTTAACTCAGACAGA
GTTGGTAGTCATAGGGTCTTCCCTATTGGCAAACTACAAGGATTGAGATTTATGTGTGGT
TTCCGGTTCAAGTTATGGTGGATGACACAGAGAATGGGTACATCTGGCCAAGATATACCA
TTTGAGACTCAGTTTTTGATTGTGGAAGGAAATGATGGTTCAAATTTTGATCAAGACAAC
CAGCAAAATTCAGCATTGTATGTTGTTTTCTTGCCTATTCTAGAGGGAGATTTTAGGGCT
GTTCTTCAAGGGAATTCAAACGACGAGTTAGAGATATGTCTGGAAAGTGGAGATCCTGCT
GTGCAAGATTTCGAGGGAAGCCATTTGGTTTATGTAGCAGCTGGACCAGACCCTTTTGAT
GTCATTACTAATGCTGTCAAGACGGTGGAGAGGCAATTACAGACATTTTGTCACCGTGAT
AGAAAGAAGATGCCAGACATGTTGAACTGGTTCGGATGGTGCACGTGGGATGCTTTCTAT
ACAACCGTTTCTTCAGAGGGAGTGAAGCAAGGACTAGAGAGTTTGGAGAAAGGAGGTATT
CCCCCAAAGTTTGTACTCATTGATGATGGATGGCAATCAGTGAGTATGGATCCCAATGGC
ATCGAATCCATTGCTGATAACCATGCAAACTTTGCAAACAGGCTAACTCATATCAAAGAG
AACCATAAGTTTCAGAAAAATGGAAAGGAAGGTCATAGGGTTAACGATCCTGCAATGGGA
CTTCGACATGTTGTTACCAATATCAAAGACCAACACAATTTGAAGTATGTGTACATGTGG
CATGCACTTGCTGGTTACTGGGGTGGTGTGAGACCCGGGGTCCCTGGGATGGAACACTAC
GAATCCAAGTTATCTTTCCCAGTTTCATCTCCCGGGACTGAGTCACAGGAACCTGATGAT
GCTTTGAGCAGCTTGATAAAGAACGGTCTTGGTCTAGTGAACCCTGAGAAAGTTTTATAC
TTCTATAATGAACTGCACTCATACCTTGCTTCTGCGGGTATAGATGGGGTTAAAGTAGAT
GTTCAGAACATCCTTGAAACACTTGGAGCTGGTCATGGTGGAAGAGTAAAACTCGCAAGA
AAGTATCATCAAGCATTAGAGGCATCTATTGCTCGAAATTTTCCTGATAATGGAATTATT
TCATGCATGAGCCATAGTAATGATAGTTTGTTCAGTGCAAAGCGTTCAGCTGTTATAAGA
GCATCAGATGATTTCTGGCCACGAGACCCTGCATCACACACAATTCACATAGCATCAGTG
GCGTACAACACCATTTTCCTTGGTGAATTCATGCAGCCTGATTGGGATATGTTTCATAGT
GTGCATCCCATGGCTGAATACCACGGAGCAGCACGAGCAGTTGGAGGCTGTGCTATTTAT
GTCAGTGACAAGCCTGGACAGCACGACTTTAATCTTCTAAAGAAGCTTGTACTTCCAGAT
GGTTCCATATTACGCGCCAAACTTCCAGGAAGGCCAACTAGAGACTGCTTGTTTTCTGAT
CCAGCAAGAGACGGGATAAGTCTTTTGAAGATTTGGAATCTCAACGATTTCAACGGAGTA
ATCGGTGTATTCAACTGTCAAGGTGCTGGATGGTGTAAGGTTGGCAAGAAGAATCTAATC
CACGATTGTCAACCAGGGACGATAACTGGGATTGTTCGCGCTATTGATGTCAATTACTTA
CCAAGGATTGCTCATGATGGATGGACTGGCGATGCCATTCTGTATTCTCATCTTCATAGG
GAATTGATCAATCTTCCTAAAAATGCTTCGATTCCAATCACTCTAAACGCGAGAGAATAT
GAAGTCTTTACAGTTGTTCCAATCAATGAAATGTCTACAGGATCAAGATTTGCTCCGATT
GGTCTTGTGAATATGTTCAATTCAGGAGGAGCAATCAAAGAGCTGAAGTATGAAACAGAG
GGAAAATGTGGATTAGTTTCCATGAAGGTTCGCGGATGTGGAATGTTTGGTGCTTATTCA
TCTGGGAAGCCTAAACGAATACAAGTTGACAATGAAGAAGTACATTTTGATTACGACGAA
TCCTCTGGATTAATCACCATTAATATTAGAGTTCCTGATGAAGAATTATACCTTTGGGAT
GTAAAAGTTGAAATGTGAAAAGTGCAAGATGATCATAAATGGATGAATTGAAGACTTGTG
AACTAAGTCTCTCTTTTCCAGTTACTCAGAGTTTTTAACTTTAGAGAGCAGTGTCTGATT
ATTATTTAAATTTTGTTACATCATAAGGTAACATGGCGAAAACTCTCATTTTATATGATA
ACTGATTTTGGTCTGATC