Microarray Probes on PGSC0003DMT400057213

Probe IDChipProbe Sequence
CUST_15175_PI426222305 JHI_St_60k_v1 GAATGGATCGAAGAAACTGAGATACAATCAATTCCTGCTTCACATTGAATTCAATTACAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400057213

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400057213 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G27030.1 +2 4e-124 365 172/299 (58%) fatty acid desaturase A | chr4:13571951-13572922 FORWARD LENGTH=323

Transcript Sequence (1212 bp)

>PGSC0003DMT400057213 1212 pgsc_dm_v3.4
ATTTTTCTTTGCATTTTGATTGCACATCCAACCTAAAAGTTCCTTCAATATGTCTTCCGT
TCTACCTCAAAACCATGCCATTAGATCCTCACAACGAGCCCTAGATAAAATTGGAACGAT
ACAGAGAAGATCCAGTACAAATCGAGCTATGAGCATCTCCCGCCATGTTCTCCTACCTGC
ACGAGTCTATTGTATCTCTTCCTCCTCCTCTTCCTCGTCCAACATTGCCACAATCACCAC
CAAACCACCACCCATCTCAGAACCACTAACTTATGACCCACTCACTCCCATCACAAAAAT
CAAGACTAGTAATAATACGAGAAGTGTACTAAATGACCCGAGTTTAAAATCCACATGGGC
TCATCGAGCCTGGATGGCAAGTGGGTGCACCACCGTGCTAATCCCCTTAGCACGGTCTGC
AGCAGGGGCACTCGACTCACATATGTGGGCCGGGCCCCTTATAGCAGGCTGCATTGGCTA
CATCGTATCAGACTTGGCTTCCGGAATCTACCATTGGGGAATTGACAATTACGGCAGCGC
CAAAACCCCTGTTTTCGGAGCCCAAATTGATGCATTTCAAGGTCACCATAAATGGCCATG
GACAATCACCCGACGAGAATTCTCAAACAATCTCCATTCCTTAGCACGCGCAGTGACATT
CACCGTCCTTCCAATCGATCTCTTCTGCAAAGATCCAACTACTCTGGCATTCGTTGGGGT
TTGTTCAGGTTGCATTATGTTCAGCCAACAGTTCCATTCATGGGCTCATGGCACAAAAAG
TAAGTTGCCTTCAATGGTGTTAGCATTACAAGACGCTGGAATACTCGTATCGAGGGAACA
ACACGCTGCCCATCATCGCGTTCCATATAACAACAATTACTGCATTGTTAGTGGATTATG
GAACACGATTTTGGATGAATCAAAGTTTTTTGAGCTGCTGGAGATGATTTTCTTCTTTAA
ATTCGGAGTCCGGCCAAGATCATGGAGTGAACCAAATTCAGAATGGATCGAAGAAACTGA
GATACAATCAATTCCTGCTTCACATTGAATTCAATTACAGTATAATTTTTTTTTTTAAAG
TTGATTGATGTACCTTTAATTTTATTTTTTCCGATTAGTATTGGAATGATATTGATATTC
GACACCAACTTGATAATAGTAATATATGTAACTATTTCAACTCCAGCCAGATTACTTAAT
AATGGAATTTTG