Microarray Probes on PGSC0003DMT400057171

Probe IDChipProbe Sequence
CUST_15275_PI426222305 JHI_St_60k_v1 GATGAGTTTGTGGCCTCATTGAATTTAGAAGCTCTTTTAGTTGATTGCATTAACTATGAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400057171

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400057171 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G55090.1 +1 2e-109 334 205/461 (44%) mitogen-activated protein kinase kinase kinase 15 | chr5:22356852-22358198 REVERSE LENGTH=448

Transcript Sequence (1380 bp)

>PGSC0003DMT400057171 1380 pgsc_dm_v3.4
ATGAGTCGAGCTGAACCAAACGATTCAATGGAGTGGATTCGGGGTCCGATAATTGGTCGT
GGCTCTTCCGCCACCGTTTCACTCGCTACCAATTCTTCTGGAGTGCTCTTTGCTGTTAAA
TCCACTGAACAATCTTGTTTGCAAAGAGAGTATTCTCTTATTTCTCAGCTGAATTCTCCG
TTTTTAGTCAAGTGCCTAGGCTTTGACATCGCTTATGAGCAAAATAAAGAAGTTTATAAT
ATGTTTATGGAGTATGTACAAGGTGGAACTCTTTCTGATTTGATCAAGAAACAAGGAGGT
TCATTGGATGAATCTATGATCAAATTATACGCTCAACAAATCCTACAGGGATTGGATTAT
CTTCACTCAATTGGGATTGTGCATTGTGATGTGAAGGGGCAGAACATTTTAATTGGCGAA
AATGGGGATATCAAAATTGCTGATTTGGGATGTGCGAAATTGCTGAGAGATGAAAAAAAT
TCTGGATTTTCCGGTACACCGGCTTTCATGGCACCTGAAGTTGCTCGAGGCGAAGAACAA
GGATTTGCAGCTGATATTTGGGCTTTTGGTTGTACAATTATTGAGATGGCTACAGGATCA
GTTCCTTGGTCTGAGATCAAGGATCCTGTTTCTGCTCTGTTTAGAATTGGTTATTCAGGG
GATTTGCCACAATTCCCAAACAATTTGTCAAACGATGCCAGAGAATTCCTTAGTAACTGT
TTGATGAAATGCCCGAATGAGCGTTGGACAGCTAAACAACTTCTTCAACATCCATTTTTG
CAATCTGTAGAGTCTAATTCATGGAATTTTGAAGAATTGAAGAGGGATTCTCCTACAAGC
ATTTTGGATCAGGGATTTTGGAATTCGTTCGAGGTGACAGAATCTTCCTCATTAGAGTCA
ACCAACACCGTTGATTCCGCTACAGATAGGATCAGACAGCTGATTGGTAATGTGGGAATA
TCATGCTCTTTGATGCCTAATTGGGTTGAGGAAGAAGATTGGGTAACAGTTAGATGCAAC
GACACAGAAGAAAATTCGATAATTTCAGAGCAAAACTGTGAGATGATCGATGATTTTGGA
GAATTGTTGGATATGGAAACATCAGTGTCAATGATTTTTTCTGAAGATGAGTTTGTGGCC
TCATTGAATTTAGAAGCTCTTTTAGTTGATTGCATTAACTATGAGATTATTAGCCTTTTT
CATACTGTTAGTAGTAGTATAAATTTGATTATTTCTCCTGAGATTGTTGGAGATGTTTTT
GTATCTGAATTCAATGATTCTGAAATAAAAAGATTGAAACTTTTTCGTCCATTCACTTTC
TCATCTGACGTTGTTACTGTTTCCATATTAGTTGTCATATTTTCTTCTTCTCGAATTTGA