Microarray Probes on PGSC0003DMT400057145

Probe IDChipProbe Sequence
CUST_14914_PI426222305 JHI_St_60k_v1 ATGAAAGGGTACTTGAAGAAGTTGGGTTTTGCTTTGACTTCATCAAAGATAAAATGGTTC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400057145

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400057145 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G34500.1 +1 9e-50 167 88/176 (50%) MBOAT (membrane bound O-acyl transferase) family protein | chr1:12611638-12612663 FORWARD LENGTH=341

Transcript Sequence (573 bp)

>PGSC0003DMT400057145 573 pgsc_dm_v3.4
ATGATTGATATTCTTGTAGCATTATCTAGCAATATTGTTAAAATAATCTTAGTGGGGTTT
GAGTTAGAATTAGAGCCACCATCAAATGAACCTTATTTATCAACTTCCCTTCAAGATTTT
TGGGGAAATAGGTGGAACCTCACCGTAACCAATACACTGCGTCTCACCATATATAACCCT
GTGAGGTCAGCATTGTCAGAAGTTGTCGGGAGAACGTGGGCCCTACGTGTTGCCATGCTG
GCAACTTTTGTCGTATCCGGTTTAATGCATGAGCTTTTGTTTTATTACGTTAATCGTGTG
AGCCCTTCTTGGGAAATGACGGGCTTTTTTGTGTTACACGGGCTTTGTGTGATGGTGGAG
ATTGGTGTTAAGAGGTGTTTGAAGGATACATGGCGGTTACCGGGCTTTGTTTCGGGCCTG
TTAACGGTTGGGTTTGTGGTGGTTACTGCTTTTGGGCTTTTTTTTCCACCAATAATTAGG
AATGGTGCTGATGAAAGGGTACTTGAAGAAGTTGGGTTTTGCTTTGACTTCATCAAAGAT
AAAATGGTTCAATTTGTTGGTTATTTTAGATAA