Microarray Probes on PGSC0003DMT400056164

Probe IDChipProbe Sequence
CUST_49355_PI426222305 JHI_St_60k_v1 TTTGCTAACTCTGAAAATTCTGGCAAGACTAAAACTATTGCAGCAGCTTGAAGGGTAATT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400056164

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400056164 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G39795.1 +2 2e-20 84 46/108 (43%) Protein of unknown function (DUF581) | chr4:18466621-18467325 FORWARD LENGTH=126

Transcript Sequence (571 bp)

>PGSC0003DMT400056164 571 pgsc_dm_v3.4
AAAAAATTTTAAAAAAAATTGCCCTTTTATAAAGAAGATGATAGGTAAAATGAGAAGAAC
AACAAGCACAACAAGGATTACCGTTGATGTGATGATCAATGGAGAAGGAAAACCGTCTGA
TCTTGATCTTGGTACTAATAATGGATTGTATGGTCATGATCATCGACACGTGTCATCAAA
ATATCACCATAGAAGTTCAAGTTATCAAGGTTTTCATCATCATATAGAAGAAAAAGCTCA
TTTCTTGACAACTTGTGGACTTTGTAACCATCGATTGACACCTTCTCGTGATATCTACAT
GTATAGGGGTGATACAGCATTTTGTAGTATGGAGTGTAGGGAACAACAAATGAAAAGTGA
TAAAAGAAAAGAGAAATTAAAGCTTCTTGTCCTTAAAAAGAAGAATGAAAATTATCAAAA
TTACTCAGAATTGCCCTTTGCTAACTCTGAAAATTCTGGCAAGACTAAAACTATTGCAGC
AGCTTGAAGGGTAATTTTGGAAAAGAAAAAAGAGAAGAGAAGAGAAGAAAATGATGTGTA
TTTATATTTAAGTAGAAAAGAAATAACTTAA