Microarray Probes on PGSC0003DMT400056052

Probe IDChipProbe Sequence
CUST_9797_PI426222305 JHI_St_60k_v1 TTGGTGTCAAACAAGTTCCCTGCGGTCACTTATTCCACTCATGTTGCCTTACAAATTGGC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400056052

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400056052 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G19950.1 +1 8e-12 63 24/42 (57%) RING/U-box superfamily protein | chr3:6942853-6943839 FORWARD LENGTH=328

Transcript Sequence (602 bp)

>PGSC0003DMT400056052 602 pgsc_dm_v3.4
GTTGATTAACGTCCTCTATTAGTCAAACCTACAAATGGACGTGAATATCACTAAAGTCCA
AAGTGAAAAATATTTTTATTTATCTAACCCTTTCCTCTTTCCACGAAGCGACCGATCCCC
CAATTGAATATATATAAATACAGCTAGCAAGCAATTCGTTGATATAATCACAATCTATAG
AGTCTGAAGATGGATGAAGTTTTCGATCTCGATCTTGCTTTAACGGTGGTGGAAGATTTC
AATGCAGCGGCGGCTTATCAACTGGAGGAGCCTTCGCCAATTTCTGATGATGAAGACGAC
GAGATGATGCCGATGGTTAATGCAGTTGGCTTTTGTTCAATCTGTATGGAAGAGTTTGAA
GCAGAAGTTGGTGTCAAACAAGTTCCCTGCGGTCACTTATTCCACTCATGTTGCCTTACA
AATTGGCTCTCCCTCCGCAAATCATGTCCTCTTTGCCGCTTCTCTTTCTCTACTTCATGA
ATTTTTTTTTTATATTTTTTTTTTTATGAATATGATTTTAGTTTATACACACTCTTATGA
GTATTTACAATACAATATTGTTAGGGTAAAAGTTGAGTATCTCCTTCTGTCACATTTCAG
AT