Microarray Probes on PGSC0003DMT400055911

Probe IDChipProbe Sequence
CUST_48228_PI426222305 JHI_St_60k_v1 ACACGAAAAAGAAACCAACATAGTCAGGGATGAGGCAATTTTGTACTTCTTTTAGTTTCC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400055911

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400055911 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G09280.1 +2 6e-09 51 26/56 (46%) unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: root; Has 31 Blast hits to 31 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr3:2850920-2851258 REVERSE LENGTH=112

Transcript Sequence (462 bp)

>PGSC0003DMT400055911 462 pgsc_dm_v3.4
CGCGCACACAATTGTAGCAATATTCATATTCTCTATGGCTAGGCTTAGTTTTCTCCTCAT
TTGCCTAGTTTTAGCTCAGGTTAGCTTGCTTATGCAAAATGCTAACGCGCTTAGAAAACT
AGACATCTTAACAGTAGTCCCAAGTCCTGCGCCGTTTGAAGGAGGAATGAACAGAGGAAG
AGGTGATCAAGCTCCAGCAGTTACACATATAAGGACTCATCATTCTTTCAACAAGTCCAT
GGCTGGTGGAGACTTGATCCTTGGCGGCTTCGCCACTGCTCTTATTGCTTCCATTTTTTG
TTACATTCGAGTCACACGAAAAAGAAACCAACATAGTCAGGGATGAGGCAATTTTGTACT
TCTTTTAGTTTCCAATTCAAATATATACACAGGATTCAAGATTTTGCTCATTTTAATTAG
ATGGCTGGATAATGAAATTATATACATTCTAGCTAGTAGCAT