Microarray Probes on PGSC0003DMT400055239

Probe IDChipProbe Sequence
CUST_44148_PI426222305 JHI_St_60k_v1 ATTAGTGGATTTGTTTGGAGTGGATATGGAATCAAGAAAGGTACCTTTGGCTTCTTTTTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400055239

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400055239 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G37650.1 +3 0.0 555 297/480 (62%) GRAS family transcription factor | chr4:17691871-17693466 FORWARD LENGTH=531

Transcript Sequence (1984 bp)

>PGSC0003DMT400055239 1984 pgsc_dm_v3.4
CTTGTTCTCTCTTTCTTTAATTATTTATGTAAATAGGCGTCAAGCTTTTAATTCCTCCCC
ACTCTTTCCTCCAACAACTCCACTTGAGTTGATCCTTTTGCTTTGAACCCATCCAACAAA
ATCACTAAAGGTACTACTAGTCTTGTACATTTATTCTTTTTAACTTTGATGTGGCAAGAG
AGATACGTACCCCCCCCTTTTGTTAAATGGATACTTTGTTTAGATTAGTTACCCTTCAAC
AACAACAACAACAACAACAATCTGATCAATACTCTTTTAACTCCAGCAGAACTTCAAGCA
GCTCTAGATCTTCTAACAAACAAAATACTACTTATAATTATCATCCACATAATAATAATC
AAGACGAAGAATGCTTCAACTTTTTCATGGATGAAGATGATTTCTCTTCTTCTTCTTCTA
AACACAACACCAACTATCCTCCTCCTCATTACAATCAATATCAACAAATTTCCAACACTC
CCACACCGACAACTACAAGCAGTACCCCGACACATCAATCTCAATCTCAATCTCATCATC
ACTATGATCATCAGTTCTCCCCAGCACGTGACTTAAATCTCGAATTCGCTTCCTCATTTT
CTGGAAAATGGGCGACGGACATTCTTCTAGAAACTTCTCGTGCCATAGCCGATAAGAACA
GTACACGTGTCCAACAACTCATGTGGATGTTGAATGAGCTGAGTTCTCCATATGGAGATA
CCGAACAAAAATTGGCTTCTTATTTTCTTCAAGCATTATTTAGCCGTATGACGGATTCTG
GCGAACGATGTTATCGTACGTTGTTATCCGCTTCGGATAAAACATGTTCGTTCGAGTCAA
CGAGGAAATTAGTTTTGAAATTTCAGGAAGTTAGCCCTTGGACGACTTTTGGTCACGTTG
CATCCAATGGTGCAATTATGGAAGCGTTAGAAGGTGAGTCAAAGTTGCATATAATTGATA
TTAGCAACACTTATTGTACTCAATGGCCTACTTTACTAGAAGCACTAGCAACCCGCACCG
ACGAAACACCGCATCTCCGCCTCACCACGGTGGTTGCCGCTAGCAGAGGTGCAGCGTCGG
TGCAAAAAGTGATGAAGGAGATTGGTAGTAGAATGGAAAAATTCGCTAGGCTTATGGGCG
TACCGTTTAAATTCAACGTGATTCACCATGCGGGAAATTTATCTGAGTTGGATATTGGTG
CGTTAGATATTAAAGAAGATGAAGCGCTAGCAATTAATTGTATTGGTGCGTTACATTCGG
TTACGCCAGCTGGCAATCGAAGGGATTATTTGATATCATTGTTTAGGAGGTTACAACCTA
GGATTGTTACAATTGTTGAAGAAGAAGCTGATCTTGATGTTGGTGTTGATGGTTTCGATT
TTGTTAAAGGTTTTCAAGAATGTTTGAAATGGCTTAGGGTTTATTTTGAATCATTAGACG
AGAGTTTTTCGAAAACAAGTAACGAACGTTTGATGCTAGAGAGACAAGCAGGACGTTCGA
TTGTTGATTTACTAGCATGCCCACCATCGGAGTCAATGGAGAGGCGGGAAACGGGGGCAA
AATGGTCACATCGTATGCATGCAGGAGGGTTCAGTCAGCTTTTATATAGTGATGAAGTTT
GTGATGATGTTAGAGCTTTGTTGAGAAGGTATAAAGATGGGTGGTCGATGGGACAGTGTG
GCGGAGATTCCGCCGGAATATTCTTGTCGTGGAAGGAACAGCCGGTGGTGTGGGCCAGTG
CATGGAAGCCTTAAAATTAAATTAGGACCAATTGGTGGTGTGGGTGGTGAGTCACCATCG
AGATCTCCCTATTTGCTCTCACTTTAATTAGTGGATTTGTTTGGAGTGGATATGGAATCA
AGAAAGGTACCTTTGGCTTCTTTTTTTTTTGTTTAAATTTTAAATGATGAATAGAATTTT
TGAGTTTTTAATTAGTAGTAACATACTAATTCTATCGGATATGATGATTAACCTTTTGTT
AACA