Microarray Probes on PGSC0003DMT400055214

Probe IDChipProbe Sequence
CUST_44096_PI426222305 JHI_St_60k_v1 GGCTATCATTATGGTGTAAATGACACAATCGTGCAATGTTTGGCTTATTAGTTAAATGGA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400055214

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400055214 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G22850.1 +3 3e-32 122 85/216 (39%) basic leucine-zipper 6 | chr2:9732601-9733284 REVERSE LENGTH=227

Transcript Sequence (1060 bp)

>PGSC0003DMT400055214 1060 pgsc_dm_v3.4
CACTCCTGACCTTACTACTTCCCTTTTCTCCTCCTAATTACCCACCCCCCTTTAGAAGCG
ATTTTCCGGCCATGTTGTCCACTTTTCCGGCCACTACTCTGTCCACTGATGGCCTTTTTC
CCTATTTATTTCCGGCTTTTGATGGCGGGTTCACTCCTTGGGAATGTATCGAACCGGCTT
TTCTATTCCCACAAGAAGTGGAAGAAGAAGAACCGGTTGTTTCACCCAAGGAATCCCCAC
CCCCTGAACCGGTTATTTTAAACTCCGATTCAGGTTCTGATGACTCCAAACCGAATTCTG
TTCACTCTAGTTCCGGTTCAGATGACCCGAACCGGAATAATAACAATAATAATAACACGA
ACCGCTGTCCTGACGAGAGGAAGCGGCAGCGCACGACATCGAACCGTGACATAGATGAGA
GGAAGCGTCGACGTATGGTATCGAACCGGGAATCAGCGAGGCGGTCCCGCATGCGAAAGC
AAAAGCATCTGGAGAACCTGCGGAACCAAGCGAACAGGCTTAAAGTAGGGAACCGGGAAA
TAATGAACCGGTTACGGTTAATTACTTACCGGTGCCAAGTGGTCCAGTGTGAGAACGAGC
GGGTCAGGACCGAATCGGCTATCCTTCGGCAAAGACTTGAGGGTATACGTCAAATATTGA
TCACCCGGCAACTTGAGCAGCAATTTAATTCTTATTCTGCATGGGCATGCAATAATATGG
AACAAAGACCTCATTAATTAATCACTTGGACCTATAATAAATCATCATTAAACGTGCTTC
TTCCTCTAATTAGCACCACTATATAACTATCAGATGAAATGAAGTCACAAGAGGATTTTC
TCTCCCTCTCTCTCTATTTCTTGTAAATTAAATTAAAAGGTGCGTATAATAGCGGTAAAG
AGATATAGTAATGTATGTAATGTAGCTACTAGCTAGGAGCTTTGAGGTTGGGACCAAATG
GTGGTTTTATTTTAAGCAAAACCAGGCTATCATTATGGTGTAAATGACACAATCGTGCAA
TGTTTGGCTTATTAGTTAAATGGAACTATTTCCTTTTTGC