Microarray Probes on PGSC0003DMT400055175

Probe IDChipProbe Sequence
CUST_44158_PI426222305 JHI_St_60k_v1 GTATGCTTAAATCTACGTCAATTAACGGATCTTTTCTTTTGTGGGTTCTTGGTCTAAATG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400055175

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400055175 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G22910.1 +3 0.0 509 251/345 (73%) N-acetyl-l-glutamate synthase 1 | chr2:9749988-9752737 FORWARD LENGTH=609

Transcript Sequence (2309 bp)

>PGSC0003DMT400055175 2309 pgsc_dm_v3.4
CGAGGTTATTGAACAAATGCACCAGTCAAACCTAATTACTGAGGACCCGTACACGTGGCG
AGTCGTTAGTTACCGGTACAAATTCTTCTAACTCCACCTACCCCCAACGCCACCCCATTC
AGCAGGCAGCTGGCATAGCCCGCCGCCGCCAAAAAGCCCACTACTGTATCGGAGTTTTGC
GTGCATTTGCTTGCTCAAACCTGAGCAACCATGGCTGCTTTGTGTGGCAATAGTATTTGG
ACTCCTCAAGCTCGAAATTGTTTTCAGCGGGGAATAACTAGTTTTAATTCGTTAAAGTTT
TTACCTTTTCAAGTTAATCGTTGTAAGAGATTGTGGAGTAGGTCATTGAAGTGCAGGGTT
TTGGGGGAAACGGACGATGTGGGTTTTGAAGTGAGTAGTGCCATAAAAGACGATCTATTT
GTTGGGTTTTTCAGAGAAGCATGGCCTTACTTTCTTGCACATCGAGGAAGCACGTTTGTT
GTTTTAATCTCAGCTGAAATTGTTGATAGCCCTCATTTGGATCATCTTCTCATGGATATC
TCCCTCCTTCATGGTCTGGGAATCAAATTTGTTCTTGTACCAGGAACTCATGTTCAGATT
GACCGGCTTCTGACTGAAAGGGGAAGTGAGGCCAAGTATGTAGGCCGCTACAGAATTACA
GACCCTGATTCACTCGAGGCAGCTATGGATACATCTGGAAGAATTCGTCTCATGATAGAG
GCGAAGTTGTCACCTGGCCCTTCATTGACTGGTGTCCGCCGACATGGAGATAATAGTCGC
TGGCATGATAGTGTTGGTGTTGCCAGTGGTAATTTTCTATCAGCGAAGAAAAGAGGAGTT
GTCGAAGGAATTGATTATGCTTCAACTGGTGAAGTAAAGAAGGTAGATGTTTCTCGAATT
CGCGAGAGGCTTGATCAGGATTCCATAGTGCTATTGAGCAATCTTGGTTATTCCAGCTCT
GGAGAAGTATTAAACTGCAAGTATGCTATATGACTTTTGATAGCACATATGAGGTTGCAA
CAGCTTGTGCCTTGGCTCTAGGAGCAGAAAAACTAATTTGTATCATAGACGGCCCAATTC
TTGATGAGTCTAGCCGTCTCATTCGTTTCTTAACTCTTCAAGATGCTGATATGCTGGTCC
GCAGACGAGCTGAGCAAAGTGAGACTGCTGCTAATTATGTAAAAGCTGTTAGTCAGGAGG
ACTTCAATCGTTTAGGTTACCATGGTTCCAATGGATCGCTCCCTTCCCAAAATGGTGATG
TTTATAGCCAAAGATACAATCCCACATTTCAGAATGGCATTGGTTTTGACAATGGAAATG
GGCTTTGGTCTAGTGAACAAGGTTTTGCAATTGGAGGACAAGAGAAACTAAGCCGATCAA
ATGGTTACCTCTCAGAATTAGCTGCTGCTGCTTTTGTTTGCCGAGGAGGTGTTCAAAGAG
TGCACCTGCTGGATGGCACTATTGGTGGAGTTTTACTAAAGGAATTGTTCCAAAGAGATG
GAGTTGGGACAATGGTTGCTAGCGATCTTTATGAAGGAGCACGGATGGCCAGGGTGTCAG
ATGTTCCTGGAATAAAGCAGTTGTTACAACCGCTAGAAGAGTCTGGAACATTGATCAGAA
GGACTGAGGAAGAGCTGGTGAAAGCACTGCACTCATTCATTATTGTGGAGAGAGAGGGCC
ATATTATAGCATGTGCAGCTCTCTTTCCTTACTTTGAAGAAAAATGTGGGGAGGTTGCTG
CTATTGCTGTTTCTCCTGATTGTCGTGGCCAAGGACAGGGAGACAAGTTACTCGATTATA
TTGAAAAGAAAGCATCTTCCCTTGGATTGCAAATGCTCTTCCTACTAACAACTCGCACAG
CTGATTGGTTTGTGAGGCGTGGGTTTTCCGAATGTTCCATTGATCATATACCAGAGGAAA
GAAGGAAAAAGATCAATCTTGCCCGTAGATCAAAGTATTACATGAAGAAGCTGCTACCCG
ATAAAAGTGGTATACGTATCGATTGCACCTTTGCATAGGAATCAAAGGTTTTTCATCTGT
CTGTGTACAAGCTCATATTTAGTGAAGTAGAAAATCAACCAATTGTTCCTGACAACTCAA
GTCATTATATAAGGGGGAGATTGATCTTTGTTGTTACTGCCTGCTATTTTCTTTTGCGCG
GTAGGTTTGGAAGAGAACTTTGATTACGATGTATGCTTAAATCTACGTCAATTAACGGAT
CTTTTCTTTTGTGGGTTCTTGGTCTAAATGTTTTGAAATAATGAGGAGAAATTCTTGATA
GAAGTTTCATAAATATTATTCTAAATTCA