Microarray Probes on PGSC0003DMT400055166

Probe IDChipProbe Sequence
CUST_44105_PI426222305 JHI_St_60k_v1 CTGTGTGTATAATGTTGGCTTTGGTTTCTCGGTTGGTTACTCAACTAATATAGTTATTAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400055166

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400055166 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G10140.1 +1 3e-07 49 49/158 (31%) Uncharacterised conserved protein UCP031279 | chr1:3322970-3323473 REVERSE LENGTH=167

Transcript Sequence (843 bp)

>PGSC0003DMT400055166 843 pgsc_dm_v3.4
CTTTAAACTGTTTTCTCCCCACTTGTTTATTTTCTTCTTATCAGTCCTTTTTTCTTGCAT
ATCTGCCAATAATACTCAACATTCGACGGTTCAAATTTTCTTTATCAAATTTTGAAAATG
AGCACAAATAAGGGTAACAAAGAGAGCAGAATTAAGAGGTGCATAAAAGCACCAATTAGA
GTTTTAATTAAAGCAAGAGACTGTTACGTCCATAACTTGATGGATTGTTCTGGAAAAATT
GGGTATGGCAGTGTTATGGGTGTTCCACAAATCTCTGCTTTGCCGAGAAGTTTCAGTGTC
AATTCATCTGTATCAAGTAGTAGGGACGAAGATTTCAGGGAGCTGGTGCGAATTGCTTCC
AGAAAAAGTCTGGTAAACAAAATGGAAACAGAGTTTCTGAAGCAAAAATCAATTGCTAAA
AATGTTGATTTGGTGCCTCGGAGTCGATCTGTTGCAATTGGACGAATCGATGAAGATAAG
CCGTGTGATTTTGGTGACGATGTGAAAGTGAATACAGATTTGTTTCTGAGAAGTAGAAGC
TGTGCTGTTTCTTCTAGAAAAACAGGGTTGTTCTGAAACAGAGGAAGAGAATTTGGAAGA
AGGAAATAAGGCTTGGTGTTGTTAATTATCTGCTTGACTGTTTCTTTGGATTGTTTTTGT
TATGGTTTCTCTTTCGCTGTTGTTGCATATACATCTTCACTTTGCACTCAATTCTGTGTG
TATAATGTTGGCTTTGGTTTCTCGGTTGGTTACTCAACTAATATAGTTATTAGTATATCA
CAAATTCACTTTTTTCTTCATTTTAATTTCTTTAATAAAAAAAGTGAATTTATGAGATAA
AAA