Microarray Probes on PGSC0003DMT400054947

Probe IDChipProbe Sequence
CUST_18193_PI426222305 JHI_St_60k_v1 CTAAGGAAAGAGCTAGAGAAATTCTCAAATTTCATGCAAAGGCATGGATGAATTCTCCTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400054947

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400054947 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G35930.1 +2 1e-126 307 156/304 (51%) plant U-box 23 | chr2:15083101-15084336 REVERSE LENGTH=411

Transcript Sequence (1402 bp)

>PGSC0003DMT400054947 1402 pgsc_dm_v3.4
CTCATCTAAAGTCTCAACAAAACTTCATCTACTAAAAAATATTCCTCTTTTTTTTTTTTG
GACATATTTGCAACTTTCTTATAAGATTGATCTCCTTCTTTGATTAATCTTGAAATTTCC
CAAAATATACAAATGGAAGAAATTCAAGTACCTCCTTATTTTATTTGTCCAATTTCTCTA
GAGATGATGAAAGATCCTGTCACGATCTCAACTGGAATAACATATGATCGAGAAAACATC
GAAAAATGGATATTCTCAGCAAAGAACAACTCTTGTCCGGCTACGAAACAGTCTCTTACA
TGCATAGAGTTGACCCCAAATGTTACTCTTCGACGATTAATCCAATCGTGGTGTACTATC
AATTCGTCCCATGGTATTGAAAGGTTCCCTACACCAAAGCCTCCGGTTAGCAAACCACAA
ATAATAAAGCTCCTAAAAGAAAGCAAAATCGCCTAAGATGCAAATGAATTCTCTCAAGAG
ACTCAGATCCATAGCTTCTGAGAATGATGCTAACAAACGTTGCATGGAATCCGCGGGGGC
AATGGAGTTCTTAGCTTCTATTATTAATAATAATAATAATTCGAATGAAGTGTTTGAAGA
AGAAGAGGGTTTCATGAGTACTAAAGATGAAGCGCTTAGCATCCTCTATCAACTCAAATT
ATCTGAAAATGGATTGAGGTCACTCATCATGAGTGGAAATGGAGAATTCATTGAGTCATT
GACACGTGTCATGCAACATGGGAGCTACGAGTCTAGGGCTTACGCGGTTATGCTAATGAA
AGACATGTTCGAAGTATCCACACCAACTCTACTTTTGAGTTTGAAGCAAGAATTCTTCAT
ACAAGTTGTTCAAGTCTTGAGGGATGAGATCTCTCAAAAGGCAATGAAAGCATCCTTGCA
AGTGTTAGTGAACGCGTGTCCATTTGGGAGGAACAAAGTGAAAGCAGCAGAAGCAGGAGC
AATTAGGGTTTTGGTTGATCTTCTGCTCGATTCATCTGAGAAAAGGGTTTGTGAATTTAT
CCTAGTTTTGTTGGATCAAATTTGTCAGAGCGCAGAAGGGAGAGCCGAGCTATTGAATCA
TCCTGGAGGATTAGCCATTGTCTCCAAGAAAATACTTAGGGTTTCTAAAGTGGGGAGTGA
AAGGGCAATCAAGATCTTACATTCAATCTCAAAGTTTTCATCAACACCAAGTGTTGTTCA
AGAGATGTTGAGTTTGGGTGTGGTGGCAAAGCTTTGTTTGGTTCTTCAAGTTGATTGTGG
AAGTAAAGCTAAGGAAAGAGCTAGAGAAATTCTCAAATTTCATGCAAAGGCATGGATGAA
TTCTCCTTGTATACCTAATAATTTATTATCTTCATATCCATTTTAGGAATTAGGATAAAA
AGAACAAACAATTGTTAGATAG