Microarray Probes on PGSC0003DMT400054479

Probe IDChipProbe Sequence
CUST_24597_PI426222305 JHI_St_60k_v1 GAGATAATTGCTTGTCTGCTGACCTCCTTTTTGTGAACATCGTGCCTTTATTACTTTTTC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400054479

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400054479 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G38970.1 +1 8e-172 518 304/653 (47%) Zinc finger (C3HC4-type RING finger) family protein | chr2:16274135-16276651 FORWARD LENGTH=692

Transcript Sequence (2575 bp)

>PGSC0003DMT400054479 2575 pgsc_dm_v3.4
CAAAATCCTAAATTTTTCTTGTTTTTTCCTCTCCTCTTCCATCTCTTCTTCTCCAAATTC
ACGTTCGTTACTTTTCTTCCATTTTACAAACCCAAACCCTAACATCAATTCCCCTCTCTC
ACTCTCTTTCTGTTGAAGGAGCTGAAAGAAAGAATGTCAGGTTCATGGAGCAAACTCCAA
AAAGCGCTTTCGTTTAGGCAACCTAAATCTCCTCCAGAAAATGCATCCTCTGATGCCAAA
TCGCCACCGTCCACTCGGCCGTCCTCCGTTGCATCTTCATCCACTTTCTCCCGTTTCACC
AGAAGTTTCAGTAGTACCTCCCGATCCTCTAAGCGAACATGTGCCATTTGCCTTGGGAGT
ATGAAAGCAGGGAATGGTCAGGCGATATTCACTGCTGAATGCGCCCACTCATTCCACTTT
AGCTGCATTGCCAACAGTGTTAAGCATGGAAACTACCTCTGCCCCATCTGCAGATGCAAA
TGGAAAGAGATTCCTCTCATGTCGTCCTTCAGTACTGATGTAAACACTAATAATGCTGGG
CGGACTCGTGTCTCTCCACTTGAAGATAATTACCTTGACAACATTCCTCGTGTTCCACCA
CCCGTGTCTCTGCCCCTTCCTGAGCCCCTTCACTTCTCTGATGATGAACATCTTCCCAGC
ATCACTGTGGATCAGACCCCCTCCCCTTCCACAGTTCATCCAGAGACTGCTGTCTTGAAA
GCTTTTCCTGAATATTCTGCAGTTGCTGCTTCTGGAAGTATGTCAAGATTTGCTGTTCTT
GTTGGAGTAAGGGCACCCCCACTTGCTGATGATGTTCGGCACCAAGAGCGTGCACCTATT
GACCTGGTCACAGTTCTAGATATTAGTGGCAGCATGGCTGGATCAAAATTGACTCTCTTG
AAACAAGCAGTTTGTTTTGTCATAGATAACTTGGGGCCTTCTGACCGTCTATCTATTGTT
ACCTTTTCATCAGGAGCTCAAAGAAACTTCCCCTTGCGAAGGATGACAGAACAGGGGCGT
AGAGAGGCTGCACTGGCTGTCAATGCCATTTCAGCAAATGGTGGGACAAATATCGTGGAA
GGACTCAAGAAGGGGGTTCGGGTTCTTGAAGAAAGACGTGAAAGGAACCCAGTTGCAAGC
ATTGTTCTCTTGTCAGATGGGAGAGACACCTATAACGGTGATAATGCCAACCAACGGCGG
AGTCCTCGGAACCGCAGATCCTCTAATGCAACCTCAGGTCCCGACTTTCTGAATCTATTG
CCTTCTTCCATTTGTCCTCGCAATAGAGAAGGACTAGCAGCAGGACAGCTGCCAACTTTC
CATGTACATACGTTTGGATTTGGTTTAGACCATGATTCCTCTGCTATGCATGCTATCTCA
GATGCATCAGGTGGTACATTTTCGTTCATTGAGACTGTTGGTACTGTTCAAGATGCCTTT
GCAATGTGTATTGGTGGTCTCCTCAGTGTTGTAGTCCAGGAACTCAAGCTTACTGTTCGG
TCAGCATCACGTGGAGTAGAAATTGGATCCATTCCTTCAGGAAGATATGCAAGTGAAATT
TCTGAACAGGGAAAGCAAGGGGTAATAAACATTGGAAACCTGTATGCAGATGAGGAAAAA
GAATTCCTTGTCTACTTGTCTGTTCCCTCAGCTGAAATTGAGCAAGGCGCAACAAAGACA
TCTCTGTTGCAAATTACATGTAGTTACAAGAATACCACATCGGAAGAGATGGTCAGTGTG
GAGGGTGAGACAGTTGAGATACGTCGGCCACCAGTGCTGTCTCCTACAGATGTGGTAATA
AGTTGTGAGGTTGATAGGCAGATAAACAGGCTGGCAGTAGCAGAAACCATTGCAGAGGCA
CAACAATTGGCAGAAATGGGAAATCTTGAGGCTGCTCAAGCCGCGCTAACTAACCGAAGA
GCCACTCTTCTATCTTCTGTATCTGCTCAAGCAGGCGATGCTCTCTGTAGCTGGCTTGAC
ATGGAATTGACTGAAGTCAGAGAGAGGATGGTAAGCAGGGAGCGCTATGAACAAACTGGA
CGAGCTTACGTCCTCTCAGGTTTGAGCTCACATTCTTGGCAAAGAGCGACAACTAGAGGA
GACACGACATCACAAATATTACTGCAAGGTGGTAGCTCAAGCAATAGTGGCGCCGCCATG
TATGAAACTCCATCTATGGTCAGCATGATCTCAAAGTCACAGAACCTAAGTCTTGTTAAT
CGCGCTGAACAAGTTCATCGCCCCAACAAGTCATGCAACTTACCTCCTCCACCATCCTAG
CAAACATTTCTGACCTCATTCGTTCTCAGCGTGATAGGCAATTGAACACAGCACTCTTTT
AGTGATCAAATTCTATGGCATTTGACTCTGCTATACTTTTGTTTTTTGGTTCCATTTATT
TGTTTCTTTTAGTTCTTCAAGGATCATTTGCATATCAGATTCTTTTAGAGACCAACAACT
CTACATATTGTAATAATATGTTAGAGATAATTGCTTGTCTGCTGACCTCCTTTTTGTGAA
CATCGTGCCTTTATTACTTTTTCTTTGATTATTCTTTAACTGAAGTAGTTCTGGA