Microarray Probes on PGSC0003DMT400054442

Probe IDChipProbe Sequence
CUST_24630_PI426222305 JHI_St_60k_v1 AGCCTAAAAGAAGCTAATAGACCGACACTTGCTTGGTACGCGAAGGAGGATGATAATAGG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400054442

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400054442 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G40010.1 +1 8e-42 147 64/143 (45%) AAA-ATPase 1 | chr5:16020218-16021762 REVERSE LENGTH=514

Transcript Sequence (447 bp)

>PGSC0003DMT400054442 447 pgsc_dm_v3.4
ATGATGATGATGCAAGATGTTTGGAATCAGTTAGGTCCAGCCATTGCAACAATCATGTTT
GCCTGGACCATGTACCAGAACTATTTCCCTCATGAACTTCGTGGTCATCTTCGAAGGTAT
ACCGATAAACTTGTGAGCTATATCTATCCTTATATACATATTACATTTCATGAATATGAA
ACTGATGGTTGGTTTGAGCGTAGTAAAGCTTATGTAGCTATCGAAAGGTATTTAAGTAAG
AACTCCAGTATACAAGCTAAGCGTCTAAAAGCCAGTGTAGTGAAAGATGGTCAATCTCTT
GTTCTATCGATGGATGATCATGAGGAGGTAACAGATGATTATGAAGGGGCGAAGGTTTGG
TGGATATCTAGCCTAAAAGAAGCTAATAGACCGACACTTGCTTGGTACGCGAAGGAGGAT
GATAATAGGGAAGGCGATTTCTGTTAG