Microarray Probes on PGSC0003DMT400054403

Probe IDChipProbe Sequence
CUST_24523_PI426222305 JHI_St_60k_v1 CATCTTCTGTTCCCCAAAAAAGGAGTTAAAATGGAAGTCGTCGCAATCGAATTTTTATTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400054403

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400054403 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G49690.1 +1 0.0 540 265/474 (56%) UDP-Glycosyltransferase superfamily protein | chr5:20189968-20191350 REVERSE LENGTH=460

Transcript Sequence (1833 bp)

>PGSC0003DMT400054403 1833 pgsc_dm_v3.4
TAATTCCATCCGATGTCCGTGTTCTGTATTAGGGTCTAACTGAATTCGAATTCGTATAAT
AAAGTCACATATTTGAGGTAAAGCTTCTCTATGAAAGGCCACTTCATATTCATGATCGAA
TTTGAGATCTCTGATTAAGGACGAAGAAATACTTATAAATTAAGAGGTTATTTGTTCTTT
CAATAGTCCTAACTTCCTTCAATGGAGAATGAAAAAGAAAGACTTCATGTAGTGATGTTT
CCATGGCTTGCCATGGGACATATCATACCTTTTTTTCATCTATCCAAGTGTTTAGCTCAA
AGGGGCCATAGAGTCACCTTCATTTCAACTCCAAGAAACATTGAAAGAGTAGTTAATAAA
GTTCCCTCTGATCTTGCTCCCCTGTTGCATATTCTGAGTTTTCCTTTGCCTAAAGTCGAA
AACTTGCCGAATGATGCAGAATCATCAATGGACATACCTTACCAAAAAGCTCAGTTCTTG
AAGATTGCTTTCGATTTGCTCGAAATCCCACTAACCAATTTTCTTGAAAGTTCATCTAAT
CCCAAACCAGATTGGATTGTCTATGACTATGCTTCTCACTGGTTACCTCAAATTGCAGGC
AAATTAGGCGTTTCTCGCGCCTTTTTTAGTCTCTTTACTGCTGCAACTATGTCCTTTTAT
GGACCTCCTTGGGCTTTGTTAAATGATGATAGGTCAATCCCTGAGGACTATACAGTTATT
CCAAAATGGATTCCTTTAGAAACGAAAGTCGTGTATAGGCTGCACGAGATTAAGAAGAAT
TTCGAAGCACCAGCTGATGAATCAGGTACCTCTGATGGAGTCCGATTCGGTGCTTCAATT
GATGGAAGTGATGTTATCTTGTTTAGAAATTGTGTTGAGTTCGAACCCGAATGGTTCAGC
TTGGTTTGTGAGCTTTATCAAAAACCTGTAATATCCATTGGTGTTCTTCCTCCATCTGTA
GTAGAAAATGAAAAATTCGACAGCAATGATACGACGTGGTTAGGAATCAAGAATTGGCTA
GATAAGCAAAATCAAGATTCTGTTGTTTATGTTGCACTTGGAACTGAAGCAACACTGAAT
CAAGAAGAGCTGAATGAGCTAGCTCTGGGGTTAGAAAAATGTGGATTACCATTCATTTGG
GTATTAAGAGATCAGCCAATACATAATCAAGAAGATTCGCGCATTCAGCTTCCTGATGGA
TATGAAGACAGAGTCAAAAACAGAGGTGTAATATACAAAGGATGGGTACCACAGACAAAG
ATACTAAGCCATTTGTCAGTTGGCGGATTCTTGACTCATTGTGGATGGAATTCGGTCATA
GAAGCGCTATGTTTTGGGCGGGTTTTGATTATGTTCCCGGTGTTGAATGATCAAGGATTG
AATACAAGGTTGTTGCAAGAGAAAGGAGTTGGTGTAGAGATACCAAGAAATGAAAAAGAT
GGTTTTTTTACTAGTGATTCAGTGGCTGAAGCTGTGAAGTTTGGTGTGGTGAGTGAAGAG
GGTGAGTTGTTGAGAGATAATGCAAGACAAATGAGTGGTTTGTTTGGAGATAGGAAGAGA
AATGAAGAACTTATTGATGATTGTGTTGGTTATTTGATGGAAAATAGGATAAGCATATCT
AAATAGATATGTCCACAATAATGAGAGTTAAATAGAAGCGGGAATCTTAATAGCCCAATT
GATTGACTATCTAATGTTTATCTGGGTTCGATTCCTTACCTTGTAATCTCATCTTCTGTT
CCCCAAAAAAGGAGTTAAAATGGAAGTCGTCGCAATCGAATTTTTATTTTTTTCTGTCAT
ATTACACCTTGTTTGAGTGGTTGTTACCGGTTG