Microarray Probes on PGSC0003DMT400054335

Probe IDChipProbe Sequence
CUST_52059_PI426222305 JHI_St_60k_v1 CCTTTTATGAAACTTTTACCCCATTAATGTTTGGTAAGGCTTGACATTCCTTCTCTGATA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400054335

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400054335 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G24340.1 +2 5e-93 317 153/239 (64%) FAD/NAD(P)-binding oxidoreductase family protein | chr1:8635416-8638866 FORWARD LENGTH=709

Transcript Sequence (3617 bp)

>PGSC0003DMT400054335 3617 pgsc_dm_v3.4
TTTTTTCTTATAAATTTTATACAAACTTGCTTTAAAATTCGTGGAATCATGCATCATTCC
AAGTCACCAATATTAATGCCACATGTGTTCAGTCAATGGTCAGAGGTGTTCAATATATTG
TGTTTCAGCGAGTTCAAGGGTCCAGTTGGCAAAGTCGTAAGTATAAGCGTCTAACATACA
AACGGAAGGACCTCCCAGACCATTCCGCCAATTATATATTCTGTCAAGTTTTATGTTAAA
CGGTCCGAAATAATGCAAAATTAAGAAGTGACTATAACCAACCTTTCAAGCAATTTATCT
CTAACAAAATGTTGTAGTAGCTCTTCTACTTCTTAAAATGGATACTGCAACTTAGTTTTC
ACTTTCTTATTGTGCCGTTGAATACAAAATGTTACATGGGACAATTTGCACTTTTATGGT
TTCTTAAGTCATCAAACTACATTTTGTTCATGTCAGATCCTCTTAACATATGAAATGGAA
TGATTGTACCCAATCCCAATCAGAGAAGATATCACTGAATAAATGATGTAAGTTCATATG
TAATTTCTGTTTTTAAAGATAGATTGCAATTTAGATTGAAATTTTTGGTGATCAAATCCA
TGAAAAAACTGGCAGATGTATAATCTGTTATTATTCCATTAGCGCATCAGACAAGTCTAC
ATACAAATGGAAGGTATGTGTCCTTAAATGAGATGGGTAGAGTAGTATGACATCCATCTT
ATTAGATACATTTATTGCATCACAATTTTATTGAGTTGCTTCGTTGACGATACATCTTAT
ATACTTATGATTGTTTTGTTTTCTGCAAACTTTTTCCTTTTTGTTGTCAGATTTTGATCA
GATTGCGAGTCCTGTCTCTGTTGCACACTTCTCCCTGTACAAGCTCTCCAGAATACTGCT
TAAGCACCTTGAGAAACTTGGTTTCCATATGGTAAACTCTGAAAAGCGTGAGTATGGCTC
TATTGGCGAGAGGGAGATCTTTATGGGGCATGAATGCATTGCAATCAATGGTGCTGACCA
TGGTGTCACTGTAACAGCCTCTTTCCTTTCTAAAGGGAAGTATGCGACGAGAGATATTCA
GTGCCATTTCCTTGTTGGTACAGACGGTACAGGAAGAAGTGTCAGAAAGTCCTTAGGAAT
CAGCATGAGAGGTGAAAAGGACTTACAAAAGCTTGTTAGTGTCCACTTCCTGAGCCAAGA
GTTAGGGCAGTATCTCATTAACGGAAGACCCGGCATGCTGTTTTTCATCTTTAATAAAGA
TGCTATTGGTGTTCTTATTGCCCATGATCTCAAGCAAGGGAAATTTGTCCTGCAGGTACC
ATTTTATCCACCCCAACATAAGCTTGAGGACTTCAGTTCGGAGATGTGTAAGAGATTGAT
GTTCAAATTGGCCGGCCTAGAGCTTAAAGACGTCAACGTGATGGATATTAAGCCTTGGGT
GATGCATTTGGAAGTAGCTGAGAAGTTTCTATCTTGTAACAACAGGATAATACTTGCTGG
TGATGCAGCTCATCGATTTTCTCCTGCTGGTGGTTTCCGTACGCAATCTGTTTGCACATT
TATCATGTTTTTGTTTTGTCAACTTAAAACTTGTAATTGTTACCTTTCTAAAAATTGGTA
TTATCTTGTCATGTCTTGGATATTATTAAGAATAAAGTTTTTGCGATTCCTTTTCGCTTG
GGAGAGTTGGGGGAGGGGAGAGAAGACAAATTAATGCAGTACATTGTTTTTCTGTCATTG
ATTCGTACAAGACTGCTTCCTAAAATGTTGATGTAAAGGTAAAAATAGCAAAGTTATTTC
TGTGGGAGGGAGATAAAAGATTTCCATGTAGCTCAAAATATTGGAGATATAATCAGCTTA
CGAGAGCATTTGTTGGTTGGAGGACATCTGAACTGCAATCAGGATCTACATTATGATGTT
AGTTACTATGCATTGCCCTGGTGATTTTAACACGGTTGATATTGTGTCTAATTATATGTA
GAGAACCTGATTGCAATGTGGTAATTTTAAATGACATAATCAATTACGTTTGTAATTGTG
TTCCCTCTCTAACCATTAAACCTTTTAGATGAAATGGTTCACACAATTCAATATGTAATC
AAAGTGTGTCCATGTTCTTTCTCTAATTACCTGTCTAAAAAATATTTCTGACATGCTTGG
CCATGAGATCCTGGGAAACACTTAAAAGGAATTCTAAAGACATAAGGCCACCAATGGGTG
TGACATAACGACTAATGAAGTGGGTATGAATTTTGGAGACCAGGGTTCAAGTACCAGAGT
GTTCCCATCTATCTAATAGAGTACCTATGTTCGTGGAAAGTAGCAAGTAACCAGTGAAAG
TAGCAAATGCAGGTAAATGAAAACCTGAAACTTAATTTTTATTACATCAATATTTCATTA
AGACATTATGTGTTTTTGCCTGGAGTACATCGAGCTCTTAATGACACTGTTGGTTCCATT
CTGCCATCTGTACTTCAAAGGACAATATTAGATAGAATATTCAGCATAGGTCGTGCACAA
CTCTCAGTTTTTGTATTGAATGAAAATAATCCACTTGGATCTGCAAGGCTAGCCAAATTG
AGACAGATTTTTGATGGACAGAGCCTTCAGCTCCAGTTCCCTGCTGAGGATCTTGGTTTC
AGGTATCGGAAAGGAGCATTGGTGTCTGAAGATGATAGTGTGTTGAATATGCATGAAGCA
CCAACAGGACGAAGAAGGGATTATATTCCTTGCTCGGAACCTGGATCAAGGCTCCATCAT
ATGAATGTTAAACTTCTTTCAATCCAATCAAGCAAGGTATGGACTCTTTCAACGGAACAT
TGCCTTTGTAGGAGCCAGACTTTGTTAGATCACGGTCTTGTTCGTTCATCTCTTGACACG
GGTGGAGAAGCCAAATAACTGAATCAAAAGAGGATTTTCTTATTTATCTCTAGCCTTGCT
ATTAGATTACAATATTCAGACTTGCAGCCATCGTATTTCAAGTCTCCATTACTATTTCTT
TTCTATCAGAATGCAATCTTATGCAGGAAATATTCTCTACTCTAGACCTTGTATATGTAG
ATAAGGTTAAGTTTGACCTTCTAATAGCACCCATTCAAGGAGTCCTACTGTCTGGCTCGA
GCTGCACTAGAGGTGGCCAGCAAATTTAAACTCCCTTTAAAGGTTTGTGTATTGTGGCCA
AACGGAAGTAGTGAAAGAGCTGGAAGAACTGAGGCTGCATTGACACCCTGGAAATCTTTT
GAAGAAGTTGTGGAAGTGAAGAGGTCATCAGATACGCCATCCTGGTGGGACATCTGTTAG
ATGACAGACAGAGGAGCCATATTAGTGAGATCTGATGAACACGTTGCTTGGCGTACAAAA
TCTAGAAATGCAGATCCCATCATGACGATGAAAAACGTTTTCCACGTTGTTACAGGAGTT
AATTGCATCTGATAGCACCTTTTATGAAACTTTTACCCCATTAATGTTTGGTAAGGCTTG
ACATTCCTTCTCTGATATACATTAGCTAGAAACAAGGTTGGTGTACTTCCCTTTCGGATG
GGTAGAGTTACCCATTACCTATACTTTCAGGTACTCAATGGAATAATTGAGGTGTAGCAA
GTTTTCGGACACCACCA