Microarray Probes on PGSC0003DMT400054270

Probe IDChipProbe Sequence
CUST_51660_PI426222305 JHI_St_60k_v1 CTCCAATTGGGCTAGATCAAGAAGAAGAAGAAGAAGGAGATTCAGCAATTATAAGTTGGA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400054270

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400054270 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G47890.1 +3 3e-133 431 345/984 (35%) receptor like protein 7 | chr1:17643976-17647035 FORWARD LENGTH=1019

Transcript Sequence (3021 bp)

>PGSC0003DMT400054270 3021 pgsc_dm_v3.4
ATTTTGGAAAATGGTTTGGTCAAGGTCTATGCTATGTGCTATATAAACCTCATAAAAATT
ATTGAATAGAGACACAAAGCAAGAATTGAAGAAATTAGTAATTTTGATATATATTTTGAG
GCACGAAAATGGGCATTGGAAAACTTGCATTGTTTCTGCTATACGCGTTTCTCTGTCAAC
TTGTTTTCTCCTCATCCTTACCTCATTTGTGCCCCAATGATCAAGCCATTGCTCTTCTTC
AATTCAGCCAAACGTTTACTATAAATCTTGGTACTTCTTCTAGTGGATCCGATTCTAAAA
CTCTTACATGGAACAAGAGCACAGATTGTTGCTCTTGGGATGGAGTTTATTGTGATGAGA
CGACGGGACAAGTGACGGAGCTTAACCTCGCTGACTGCGAACTTCAAGGCAAGTTTCACT
CCAACAGTAGCCTCTTTCAACTCTCCAATCTCAAAAGGCTTGATTTGTCTAATAATGATT
TCTCTGGATCGCTCATTTCACCTAAATTTGGTGAACTTTCTAGTTTGACGCATCTTGATT
TGTCGAATTCAGGATTTTCTGGTCTAATTCCAACAGAAATCTCTCGTCTTTCTAAATTAC
AAGTTCTTAGTATCCAGAGTAGTCTATTAAGTTTTAAACCTAACAATTTTGAACTGCTCC
TTAAGAACTTGACCCAATTAAGAGAGGTTGAATTTTACGATGTGAACATCTCTTCCACCA
TTCCTCTTAATTTCTCTTCTTATTTAACTACTTTGTTCCTTCAGAACACACAGTTATACG
GGGTACTGCCTGAAAGAGTTTTCCACCTTTCCAACTTAAAATCTCTTGATTTATTAGACA
ATCCCCAGCTCACTGTTAGGTTTCCCACAACCAAATGGAATAGCAGCGCATCACTCATGG
AGTTAAATCTCTATAGTGTGAATGCTACTGGCAGGATACCTGAATCATTTGGTCATCTAA
CTTCACTAGATAGATTGACAATAGCTTCTTGTAATCTGTCAGGGTCTATTCCTAAACCTC
TATGGAATCTCACCAACATATATCATTTGGACCTTGGTTATAACCATCTTGAAGGACCAA
TTTCCGATTTCTTTAGATTTGGAAAGCTTACAGAGTTATATCTTGGAAATAACAACTTTG
ATGGCCAACTTGAGTTCTTATTCTTTAATGGATGGGGGCAACTTGAACAGCTAGATTTTT
CATTCAATTCCCTAACAGGTCCAATTCCTTCTAATTTAAGTGGTCTGCAAAACCTTCAAG
TTCTCTTCTTGTCATCAAACCACTTGAATGGGACTATACCTTCATCGGTATTCTCCCTCC
CTTCACTAACTAATTTAGGCTTGAGTGATAACCATTTAAGTGGAAAAATTCAGGAGTTCG
AGTCCCAAACATTGTCTGAAGTTGATTTAAAACAAAATCAGTTGCAAGGTCCTATTCCAA
AGTCACTCCTAGACCAGATGTCCCTACAACATCTTCTCCTTTCGTACAATAATCTAAGTG
GAAAGATTGCTTCAATCATCTGCAATGTGAACATGCTACAAGTGCTAGATTTAGGCAGCA
ATAATTTGGAGGGAGCAATCCCACAATGTTTGGGTGAGATAAGTAGACTTGTGATTTTGG
ATTTAAGCAACAATAGTCTTAGCGGGACAATTAATACAAATTTTAGTATTGGAAACCAAC
TCAAGGTCATTAAATTGCATGGGAATAAGCTAGAGGGGAAAATCCCACGATCTTTGATCA
ATTGCACGTATTTGGAAGTTCTTGATTTAGGTAACAATGAGTTGCATGATACATTTCCAA
AATGGTTAGGAACTCTATCGAATTTAAAGATTTTAAGCTTGAGATCAAATATGTTGCATG
GTCCCCTCAAAGTTTCAAAGAACCAAAACTTGTTTGACCGACTTCAAATTATAGATGCCT
CATCCAATGGATTTAGTGGGAGCTTACCAGCAAGTCTTTTTGAGAATTTCCAAGCCATGA
GGATAATTGATCAGAACGTGACAACTCCAGGGTATTTAGGAGATGTAGAGTTAATTTATG
TGTCTCATCTGAGAACCCCAGTGTATGTAGGTGATCTTTTTTCTGTTTATAAGTATGTGA
GTGAACTTACAACAAAGGGACGAAATCTTGAATCGGTTCGAGTCTTTCCAAAAAACATAT
TTATTGATCTTTCTAACAACAGATTTGAAGGTCAGATACCAAGCATTATTGGAGATCTCA
TTGGACTTCGTACTTTGAACTTATCTCATAATGTCTTGGAAGGTCATATACCAGTGTCAT
TGCAAAATTTATTGGTACTTGAATCATTGGATCTCTCATCCAACAAAATCAGCGGAGAAA
TTCCACAACAGCTTGTATCCCTCACATTTCTTGCAGTCTTAAATCTTTCTCACAATCATC
TTGTTGGATGCATCCCCAGAGGAAAACAATTTGATACGTTTGGGAATAGTTCATACCAAG
GGAATGATGCGTTACGTGGATTGCCACTCTCAAAAGATTGTGGGGGTGATGAAGGGGTAC
CACAAGCAACAACTCCAATTGGGCTAGATCAAGAAGAAGAAGAAGAAGGAGATTCAGCAA
TTATAAGTTGGAAGGCAGTTCTCATGGGTTATGGTTGTGGACTTGTTATTGGACTGTCCA
TAATATACATAATGTTGTCAACTCAATATCCAGCATGGTTTTCGAGGATGGATATAAAAT
TGGAACACATAATTATTACAAGAATGAAAAAGCACAAAAGATATTAGTTTGTTACCTCCA
GGTATTCAATTTGATCTTTAATTATCAATGAATTTGCTCACCTCCTTCATCCTTAAAACT
CTTAACTTTGAATTCTTTTTTAAAAAAAATAATTGCAGGATTCAAGTCTAATATGTTGTT
GGTGATGCAAATAAAAGCTTTTAGTTTACTAGTTTGTGATGTATTTGAAGTGTACATTTC
CCTATGTATAAAAGCATTAATTTTCGTTTATCAATATTTTGTCAGCGTAATTATTAGTTA
GGTAATTGGATTCGACTGCAA