Microarray Probes on PGSC0003DMT400053851

Probe IDChipProbe Sequence
CUST_51616_PI426222305 JHI_St_60k_v1 TTGTGACTCTCACGGCTGCTCGTGGAACTATTGAATATGTTGCTCCAGAGTTGATTAGCA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400053851

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400053851 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G38280.1 +3 9e-59 204 100/209 (48%) PR5-like receptor kinase | chr5:15293325-15295838 REVERSE LENGTH=665

Transcript Sequence (1161 bp)

>PGSC0003DMT400053851 1161 pgsc_dm_v3.4
GTAATATTGGTAATGAAAAGATCACAAAGCTTCAATAATTGCATTTACTCAACAATAATT
GTGAAGTCTCAGCTGAACCTGAGTAATACACAAATGTCTAAAGGAAACTCTCAGCTTAAA
CATCCAATGCTTGGAAGATCAACTGTCCTGATTCTGCTTGTGGCGATATCCGTAACATAA
GACACCCTTTTCATTTAAACACCGATCCAAAATATTGTCATTTATAAGCTTTTCATCTCT
GTGGTTCGTTATGACTTTTCAAACGTGCAGTGTATTCGGGAGCAAAATTTGTGATCAGCC
TTCCGTTATTAATTGCATTTCAGGTGTACAAATTCCAAAGGAGGCATTTGTCAATGTATG
ATACGATTGAAGGCTTTTTGCAAACACAAAACAATTTCATGCCAATCAGATATAATTACT
CCAACATAAAGAGAATGACAAGAGGATTCAAAGAGAAATTAGGCGAGGGGGGTTATGGAG
CTGTGTACAAAGGAAAGCTTCAAAGTAGAAGGGATGTAGCAGTGAAGATGTTGAGCAAGC
CTAAAGCTGGTGGGCAAGATTTCATGAATGAAGTAGCTACCATCGGAAGGATTCATCATG
TCAACGTAGTTGGAATCGTGGGGTATTGCGTTGAGGGAACAAAGCGTGCTCTTGTATACG
ACTTCATGCCCAACGGATCACTTGATAAGTACATCAGCACGAGTCAAGAAGGAAGTCCTC
TGTTAAGTTGGCAGAGGAAGTATGACATTATTCTTGGAGTGGCTCGGAGGAATTGGGTAT
TTGCATCGAGGCTGTGATGTACGAATTTTGCATTTTGACATCAAACCACACAACATCTTT
TGGATGAGAATTTCATTCCAAAGATTTCTGACTTTGGGCTTGCGAAATTATATCCAACAG
ATAAAAGCATTGTGACTCTCACGGCTGCTCGTGGAACTATTGAATATGTTGCTCCAGAGT
TGATTAGCAGAAGCATTGGAGCAATCTCGTACAAAGTTGATGTTTACAGCTTCGGAATGC
TGCTTGTTGACACCCAATTTTGACCCTCCCCGATAATAATTAGTTTTGAGCTTCTTAATT
TTCAAAACGATTTAGAATAATTAGCTTTATAAAATTCAAAATAATTTCAAGGTTATTTTA
AGTAATTTCAATCGATTTTTA