Microarray Probes on PGSC0003DMT400053837

Probe IDChipProbe Sequence
CUST_29771_PI426222305 JHI_St_60k_v1 TTTTGACCTGGCTTGTGTTCTGCCAGTATAGGTACTTATAACAGCAAACCGAGCGGTTTG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400053837

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400053837 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 ATMG00070.1 +2 1e-37 129 63/75 (84%) NADH dehydrogenase subunit 9 | chrM:23663-24235 REVERSE LENGTH=190

Transcript Sequence (420 bp)

>PGSC0003DMT400053837 420 pgsc_dm_v3.4
CAAGAAATGGGTCAAAAAAATGGAAAGATCAGAACATGGTAATACATCTGATACTAATAT
GGACTACCTATATCAATTGTTGTGCTTTCTGAAATTGCATGCGCATACAAGGGTTCAAGT
TTCGATCGATATTTGCAGAGTTGATTGTCCCTCTCGAAAACAGAGATTTGAAGTGGTCTA
TCATTTACTGAGTATTCGGTATAACTCATGCATTCGTGTACTGACCTTTTTCTGTTAGCA
AGTAAAGTATCTAATTTGGCATGTAAGAATTAGCTCGCAGGATACCTAGAGGACTAATCG
ACTTAAAATCAGCCAACTAAGTACAAATTTGTCTCAAGGAATGAAGGCATTATATTTTGA
CCTGGCTTGTGTTCTGCCAGTATAGGTACTTATAACAGCAAACCGAGCGGTTTGTCTTTT