Microarray Probes on PGSC0003DMT400053696

Probe IDChipProbe Sequence
CUST_35000_PI426222305 JHI_St_60k_v1 GCAAAATTGCTAGGTGCAGGGGAGGCTTCTTTTGTTCAAACAAGGACAATTGCAACTATT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400053696

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400053696 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G47570.1 +1 0.0 562 352/906 (39%) Leucine-rich repeat protein kinase family protein | chr3:17527611-17530748 FORWARD LENGTH=1010

Transcript Sequence (2979 bp)

>PGSC0003DMT400053696 2979 pgsc_dm_v3.4
ATGGCAAGAACTTGCAATCTTCTCTTTGCTCTTGCAATTTTCATTATGCTTCATCGCCAT
ACTTCTTCACTTGCTACTATTAGCACTGATAAAGCCGCTCTTCTTTCGTTGAAATCTCAG
ATTTCCTTTGATCCTAACAACATCCTAGCAAGAAACTGGTCTTCTTCCAGCCCAGTTTGC
AGCTGGATTGGAATCACTTGCAGCTCCCGCCACCACCGAGTCACTGCTTTAAACATATCT
AGCATGCAACTTCATGGTACCATTTCTCCACACCTTGGAAACCTCTCATTTCTTGTTTCC
CTCAACATAAGTTACAATGCTTTCTATGGAGATTTACCAGTAGAGTTGGCTCATTTGCAG
AGGCTGAAATTTATAAGTGCCACAAGTAATAACTTCACCGGAGCCATTCTATCATCTTTA
AGTTTGTTACCGAATCTACGCTTTGCGTACCTTTCGATGAATCAATTTTCAGGAGAAGTT
CCTTCTTTCATTTCCAACATTACAAAGCTGGAAGTGTTGAGTATGCAAAATAATTTTCTA
AAAGGAGAGATCCCTCGGGAACTCGGTGATCTTTGCTATCTGACCTATTTAGATCTGCAA
TTTAATGAACTTAGTGGCTCTATACCAGCATCAATCTTCAACATTACAACTATGAAAAAC
ATTGGTCTTACCTATAACAATCTTACTGGTCAGCTTCCAACAACTATATGTGACCATCTT
CCAAATTTGAAAGGGCTTTACCTCTCAAGAAACTACCTCGGTGGTGTGATTCCACCAAAC
TTAGAAAAATGCAGAAAGCTTCAATTTTTGTCATTGACTTACAATGAGTTTACTGGAACT
GTACCAAGAGAGCTAGCCAACTTAACAGCTCTTACAAAATTATATGTCGGAGGTCTTCAT
TTGGAAGGAGAGATACCAGTGGAGCTCGGTAATCTGAAGAAACTACAAGCACTAGGATTA
TCAGGGAGTCGGTTTAGTGGTTCTGTCCCTGCAAACATTTTCAACATGTCATCACTGCAG
GCCCTAGATATTGCACAAAACAAACTTTCAGGTACTCTACCTTCAGATTTAGGTTGTGCA
ATGCCCAACCTAGAAAAATTCCTTTGTGGAGGAAATCATCTTAGTGGTTTTATCTCTCCT
ACTATCTCAAATTCTTCAAGACTCAGAATACTTGAGCTCTCAGGCAATAGTTTCACAGGT
TCGATTCCGGGATCACTTGGTAAGTTAGAGTACCTTGAGTTTCTGAGCTTGTGGGGGAAT
AATTTTGTCGGCGATTCAACATTGAGCTTCCTCACATCATTGACAAAGTGTAGGAAGCTA
AGATCACTCTGGTTTGATAGAAATCCATTGGATGGTGTCTTACCTGCATCAGTTGGTAAT
TTCTCAAACTCACTGCAAACTTTTGGAGGAGATGGTTGTAAATTGAAGGGCACCATTCCT
CGAGAAATTGGTAATCTTACAGGAGTGACAAGGATAGATCTGCAATACAACGAGTTGACC
GGACATATTCCAAATACTGTCCAAGGAATGTTGAGCCTTCAAGAACTTTACCTACAAAGC
AACAAGATAGAAGGAACCATACCAGATGTTATGTGCAGTTTGAAGAATCTTGGTGCGTTA
GACTTGTCAAGAAATCGGTTTTCTGGTTCAGTGCCACCATGCTTAGGGAATGTTGCTAGT
TTGAGGACACTTTATCTAGCTGTTAATAGGCTGAATTCTAGATTACCTGCAAGCTTGGGG
GGCCTTCGTGATCTCATAGAATTCAATATTTCATCAAATTTATTGAGTGGAGAAATTCCC
TTTGAGATTGGAAACTTAAAGGCTGCAACACTCATTGATCTATCAAAAAATGATTTTTCT
GGTAAGATTCCTAGCACTCTAGGGGGTCTAGATAAATTGATTAATCTTTCTTTGGCACAT
AATAGATTAGAGGGGCCTATTCCAGATTCATTTGGCAAAATGTTAGCTTTAGAATTCTTG
GATTTGTGCTATAACTATCTTAGTGGTCAAATTCCGAAGTCATTAGAAGCTCTTGTGTAT
CTCAAATACATGAATTTCTCATTCAATAAACTCAGTGGAGAAATTCTCACTGGTGGTCCT
TTTGCTAACATCACCAGCCAGTCCTTCCTATTCAATGATGCATTATGTGGTGACTCTCGG
ATAGGATCACTCCTCGCGTTGACTGTTGGATATGCGGTGTTAAGATTGAGAAAGACAAAG
AAAAATGCAAGTCAAGTAGATGTGTCTTTGGTAAAAGAGCATGAAAGAATTTCCTATTAT
GAACTTGAACAGGCAACTGAAGGATTCAATGAAAGCAACTTGCTTGGTAGTGGGGGTTTC
AGCGCGGTCTACAAAGGGATACTTAAGGATGGTACTCTTTTGGCAGCAAAGGTATTCAAT
GTACAATTGGAGGGTGCATTCAAAAGTTTTGACATGGAATGTGAGATACTCCGGAACCTT
CGCCACAGAAATCTAACCAAAGTCATCACCAGCTGCTCCAACCTTGATTTCAAAGCCCTA
GTGCTGGAATACATGCCCAATGGGACACTCAATAAATGGTTATACTCCCACAACTTGTTC
TTGAATTTATTGCAGAGATTAGATATAATGATCGATGTTGCATCAGCAATGGAGTATCTC
CACAATGGCTATTCAACACCTGTGGTGCATTGTGACTTGAAGCCAAGCAATGTCATGCTA
GATCAAGATATGGTTGGCCATGTCAGTGATTTTGGCATTGCAAAATTGCTAGGTGCAGGG
GAGGCTTCTTTTGTTCAAACAAGGACAATTGCAACTATTGGATATATCGCTCCAGAGTAT
GGACAAGATGGAATAGTATTCACGAGTTGTGATGTTTATAGTTTTGGCATACTAATGATG
GAGACGTTCACAAGAAGAAGACCAAGTGATGAAATATTTACAGGAGAAATGAGCATACAA
CGTTGGGTTAGTGATTCCTTTCCAAGTGGAATTCATTAG