Microarray Probes on PGSC0003DMT400053675

Probe IDChipProbe Sequence
CUST_35019_PI426222305 JHI_St_60k_v1 TGTGGTGTCAATGTTCCTTTTAAGATTAGCCGTGATGTTGACTGCACAAAGGTGAAATGA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400053675

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400053675 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G08770.2 +1 3e-25 94 44/91 (48%) lipid transfer protein 6 | chr3:2664330-2664784 REVERSE LENGTH=117

Transcript Sequence (360 bp)

>PGSC0003DMT400053675 360 pgsc_dm_v3.4
ATGGCCAGTGTGCTAAGCAAGACATTTCTTCTTTCTTTCCTCCTCATTTGCTTGGTGTTG
TCACCGCCACAAACTAGGGCGGTGATAACATGTGACACGGTATTCAGCGACTTGAAACCG
TGTCTTAGTTATGTGTTAGTTGGTGGAAATGTACCAACAGAATGTTGCAACGGGCTTAAA
TCTCTTATTACTAATGCAACTACCACCGAGGATCGCCAGATGGCATGCTCATGTGTGAAG
AATCTCGCCACGGCGGCAACGGATGAACAAGTTGATCGTGCCGCTAGTCTCCCCGGAAAA
TGTGGTGTCAATGTTCCTTTTAAGATTAGCCGTGATGTTGACTGCACAAAGGTGAAATGA