Microarray Probes on PGSC0003DMT400053402

Probe IDChipProbe Sequence
CUST_19681_PI426222305 JHI_St_60k_v1 TGAGTTACTGTTGAGGTTGGGTTAATTAACGTTCTGTAATTAAGCTTACGGAGATGAAGA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400053402

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400053402 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G10250.1 +1 1e-46 159 82/136 (60%) HSP20-like chaperones superfamily protein | chr4:6370537-6371124 FORWARD LENGTH=195

Transcript Sequence (934 bp)

>PGSC0003DMT400053402 934 pgsc_dm_v3.4
CAGAAAATTAAACTCTCCAGAAACTTGTAGACCATTCACAGGAGAACTATCCTTTGCCTT
TTGCTTCAACATCTATATAAACTCCAACTCTCCAATTCCATTAATCATCATAACAAAAAT
ACAATTCTCATTCACATTCTTAAGCTGCTCTACTTACCATCATCAAATCAGGAAAAAAAA
AAAATGGCAAAATCAAATGTTGGTGTTATGAGTTTTCTTGTCTTAGCAACAATTCTAGCC
ATTCTTCCATCAAAAACCCAAGCTTTAATGCCATACACACGCCCATTCTTCGACTTAATG
TTCCCACAAGAAGACCCATTTAAGATTCTTGAACAAAACCCACTTACAATCCCTAAAGGT
ATTGATCAATCAATGGCCTTATTAGCTCGTTCAGATTGGAAAGAAACATCGAAAGAACAC
ATAATATCACTTGACATTCCTGGGATGAAAAAGGAAGATATCAAGATCGAGGTTGAAGAA
AACAGAGTATTGAGAATTAGCGGAGAGAGAAAAACAGAGATGGAGAATATTGAAGGTGAG
AAATGGCATAGAGTTGAGAGAACTTCTGGAAAGTTCTGGAGACAGTTTAAGCTTCCAAGG
AATGTTGATTTGGAACATATTAAAGCTAATTTGGAAAATGGGGTGTTGAAGATTACTGTA
CCAAAATTGGCTGAAGAAGAGAAGAAACAGAGTAAAGTGATTAGTATTTCTGAACAAGTA
AATGGTGCTGGTGGTGAAGATATTAAAGCTACAATGTGATTATTTTTCATAATCATCATG
TGTTTTTGTTTTAATCATGTTGGTTGTTTGAGTTACTGTTGAGGTTGGGTTAATTAACGT
TCTGTAATTAAGCTTACGGAGATGAAGATTATAATAATATAATTGTAAGAGTCTCTGCTT
GTCTTATCAATTATGTGACATGTTTTACTATTTG