Microarray Probes on PGSC0003DMT400053173

Probe IDChipProbe Sequence
CUST_11377_PI426222305 JHI_St_60k_v1 CTAACAGCTCATGATCTTAGGACCGTTGATGATCAAATTTGATTTAATCTAACGGTTGTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400053173

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400053173 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G07350.1 +1 4e-75 240 144/311 (46%) Protein of unknown function (DUF506) | chr3:2347674-2348570 FORWARD LENGTH=298

Transcript Sequence (1352 bp)

>PGSC0003DMT400053173 1352 pgsc_dm_v3.4
TCTTATTTTATATCCTAAATTTAAAAGTTTTAAACAATTTTAATATATTTTCTTCACAAA
AAAAAAATGTCTGGAAATGGCAGATTGAAGAGAGTTACTGACCCGTTAAACGATAAAGTG
AAAGCTCGAATCGTCGGCGCCGATCTCCGGGAACTTGGTTACGTCAGCAGCGGCAGTGAA
CACAGCGCCGATGCTGATAGCGACGTCGTTTCACCTAGCTTTTCAGGTCTCGTTTTTGGC
TTCTCCGATGATTTGGATCAAAATCAGTCGTCGGAAAATGATAACTCCGATACTGAGTTA
GATGAGTCGTCAGTTGATAACGTACCGGAGATGATTTTTCAAAGCGATACAGATTTGTTT
AGGAATGTGCTGTGTTCTCACGTATTTAAAGCGTTAGAAGTTTATTCGTGTATGAAATCG
AGTAAATCGGTACTCAGAAGGAATGTAATGATGTGTTTGAGAGATTTTGGTTATAATGCT
GCGGTATGTAAAGCAAAATGGGAGAGCTCCGGTGGACTTACCGCCGGTAACTATGAGTTC
ATCGATGTCGTTCGATTGGACGCCGTTAACAGTCAAACTCGTTACTTCATCGATTTGGAT
TTCGCCGCGGAATTCGAGATCGCGAGACCGACGAACTTCTACGAACGGTTATCGCAGTTG
CTACCGAAGGTTTTCGTCGGAAAAAGCGAAGAATTAAAGCAGATACTGAGAACAATGAGC
GATGCCGCTAGACGATCGTTGAAAAGCAGAGAACTACACCTTCCTCCATGGAGGAAACAC
CGTTTCATGCAGAACAAATGGCTCGGTCCGTACAAACGGACGTCGAATATCACTCCGTCG
ACTAACACTCCGGCGTTGTTTTTACCTCCATCGAATCAGGCATACACCGTAAAGTGCCGA
TCCGTTGGGTTCGAAACCGCCGTTCACGGCGGTCTCTGGTTGCCGGCGGTAACCCGGACT
AGATGACTTCTGATAATGGAGTATTATTATTTTTTATTTTTTTTAAAAGAGTCGTCGTTT
TGTGTTTAACAAATCGTCGTCGTTTTGTGTACCATGTGAAAAAAGAGATAAAATAATTAT
CCAAACATGGTGTAAAAAGTGTAACGCGGCAAATACCCATTGTGTGCTTTTGTTTATTTT
CTTTTTATTAAGCAAAAGATTCACGTGCTAACAGCTCATGATCTTAGGACCGTTGATGAT
CAAATTTGATTTAATCTAACGGTTGTTATAATTTTTGTTATAATCATTATGATGGTGATG
TATATTAATGGATTAATGGGCCCAAAATGTACTATAAATTATCTTATCCATGGGATTAGA
TAAAGAAGATATCGATATGAGGTTGACGTGGC