Microarray Probes on PGSC0003DMT400053122

Probe IDChipProbe Sequence
CUST_31825_PI426222305 JHI_St_60k_v1 TCATGGATGAGAGAATCTGAAACAATGAATGATGGTTGTGCATGGAGAAAATATGGGCAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400053122

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400053122 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G56400.1 +2 7e-35 131 94/279 (34%) WRKY DNA-binding protein 70 | chr3:20909082-20910409 REVERSE LENGTH=294

Transcript Sequence (1057 bp)

>PGSC0003DMT400053122 1057 pgsc_dm_v3.4
CTTGGAGCTTCCTTTCATGTTCTTATCTCTTTCCTTCTCACTCTCACCCACCATATATAA
CTTATAGCCCCATCACTTCCCATATTCTCAGATCTTATAATTTAAAAAAATGGAGGAATT
TCTTGGTGAAAACCCACATAAAAGATTGATAAAAGAACTTGTTGAAGGAAAAATATTCGC
TGTCCAACTTCAAAGTCTACTTAAACAACCTAATGAATCAGTCTTAGCTGATGAACTTAT
TCGAAAAATCTGGGGATCTTTTACTCAGGCAATTACTGAGTTGAATAGTTTGGGCAATTC
CGATAATAGTTTAACCCAGAGCCAGATCGAGGAAGTTGATCAACCCAATTCGGGTTCTGG
ATTGAAGAAGAAGAAGAAGGAGAAGCAGGACCGGAGAGGTTGCTACAAGAGAAGAAAAAC
TTCAGGTTCATGGATGAGAGAATCTGAAACAATGAATGATGGTTGTGCATGGAGAAAATA
TGGGCAGAAGAAAATACTCAATTCAAAATATCCTAGGTGCTACTATAGGTGCACCCATAA
GTACGATCAAGAATGCCGGGCCACAAAACAAGTTCAAATAATCCAAGAAAATCCAATAAA
AATGTACCACACCACATACTTTGGCAATCACACTTGCAATTCAACAAAGATTCCAAAACA
TACATATAATTCACAATTCAATCATGCTATGGTAAAGCACAGTGACTCTACAGTACTAAA
AGAAGAAGAAGAAGAGGAGGAAGAATCCAAAGGACAAAGTGATAATGCATCATCAATTGT
GGATTCTAATTTATGGCAAGATTTTATGCCTTCTTCTCCCTCTGCTCATGATTCCACTTT
GACTGCTAATTATAATGCTGCTTATTATGAAGGGGTCATATCTAGTCATGATATGGAAGA
TTTGGCTAAATTTGGTGAAATTGAGGCAATTGAGTTTTGTTGACATATTGTTAATAGTAA
TTAATCCTTATGGGCTATGGCTAATGTTGTAGAATAAAACCTCTGGCTATGTTCTTGTAT
TACTTTTAAATGAAAAAAAGGTATATAGTAATTTCTC