Microarray Probes on PGSC0003DMT400052732

Probe IDChipProbe Sequence
CUST_26936_PI426222305 JHI_St_60k_v1 CCATAGATTGCAAACACTAGGCCTAAGTTGCTGGAGACACTTGGTCATAAAGTCACATGT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400052732

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400052732 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G32270.1 +2 9e-38 134 67/142 (47%) Ubiquitin-like superfamily protein | chr4:15575015-15576360 REVERSE LENGTH=239

Transcript Sequence (736 bp)

>PGSC0003DMT400052732 736 pgsc_dm_v3.4
TTTTAATATTAGAAAACTTAAGGAGATCAAATTAGAGATCTTTAAAATGGTGATGTTATG
AATCAAGTATAGTTTTAGTTTACTACTTATAAATGGTGTACTAGTTATGGAAGTTTTAAA
GAGGGATGAAGAAGATGTTAGTCCTAGATTTTCATTTCAAAAGAATGGATCATCATTGTC
TTGTGTAGTACCACCATTTTTGCTCAGCCCACAAAAGAGCTTGTACTACAACAAGTTGCC
TGAGGAGCCATTCAATCTCACAATACTCAAATTGGATGGCTCTTCCTTTGATATTAAAGT
TGCAAGGAATGGGACAGTGGCGGAGCTGAAACAGGCGGTGGAATCTGTCTTCAGTAATTT
TCCGAAGACAGGAACAGGCAAGGTTTCATGGTCACATGTATGGGGACATTTTTGCTTGAG
CTACGATGGGCGGAAGCTACTTACTGATAGTGATTTGTTAGGAACCTATCGGATCAAGGA
TGGCGATAAGCTCAGTTTTATGAGGCATGTCTCCATCAGTTACAATCTGGTCAAAACGCG
ATCAGAGAGAGAGGACCCTAGTAAGAATGAACCTAGCATGTAAGATATGTATATTGTTTT
CATCCTTATTGTTGGTTCATGTGTTCTAATATTGCACTTCACCCATGCCTGTTATGGTAT
TGTTTGCTATCGATGCTTGATTCTTCCATAGATTGCAAACACTAGGCCTAAGTTGCTGGA
GACACTTGGTCATAAA