Microarray Probes on PGSC0003DMT400052636

Probe IDChipProbe Sequence
CUST_19034_PI426222305 JHI_St_60k_v1 AAGACCTGATAATTTGTACCTTAAATACAGATGGCAGCCTTTTTCTTGCAACCTGCCAAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400052636

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400052636 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G42570.1 +2 1e-169 488 215/317 (68%) TRICHOME BIREFRINGENCE-LIKE 39 | chr2:17717498-17719921 REVERSE LENGTH=367

Transcript Sequence (1577 bp)

>PGSC0003DMT400052636 1577 pgsc_dm_v3.4
TGCTTTCTTCCTCCCTCTCTGCTTTCCCCTGTTCCACCCAACCCCACCCACCCCACTCCC
TCTCTTTATATATACACTGTACTAACATTTTCATTTGAATTTCAACACCCAAATTAAAAA
CATGGGGTTCCTATTTCTCTCACTATTATTGCTTTTCTCAGTAGAAACAAAAGCAAAAAC
AGAGCATTTTTTTCTGAACAACACCAGCAGCACCAGCAGTAGCAACTCCATAAATGGAAT
TAAAAGTAGTTGTAATATTTACAGTGGCAAATGGGTTTATGATTCTTCATACCCTCTCTA
TGATTCTTCAAATTGTCCTTTTATTGACAATGAATTCAACTGCCAAAAGTACAAAAGACC
TGATAATTTGTACCTTAAATACAGATGGCAGCCTTTTTCTTGCAACCTGCCAAGGTTTAA
TGGGTTGGTTTTCTTGGAGAAATATAGGGGGAAGAATATAATGTTTGTGGGTGATTCATT
GAGTTTGAATATGTGGGAATCATTAGCTTGTATGATTCATTCATGGGTGCCAAATGCTAA
AACTGCTGTCATAAGGAATGAAGGAATTGCTGAAATTGTATTTCTGGATTATGGAGTAAG
ATTGTTATTGTACCGGACTCCTTACTTGGTAGACATGGTGAGAGAAAATGTTGGAACTAT
TCTAAAGTTGGATTCTATAATAAGTGGCAATGCTTGGAGAGGAATGGACGTCTTGATTTT
CAACAGCTGGCATTGGTGGACCCACACCAAAAGTTCTCAACCGTGGGATTATATGCAAGA
AGGTAATAAAGTATTTAAAGATATGAACCGTTTGGTAGCTTATTACAAAGGGATGTACAC
GTGGGCAAAATGGGTTGACCGAAATGTTGACTCATCTAAAACCAAAGTCTTCTTTCAAGG
AATTTCACCAACTCATTACGAGGGAAAAGATTGGAATGATCCAACAAAATCATGCAAGAA
TGAGAAACAACCCTTCTTTGGCATAAGGTATCCAGCAGGGACAACTCAAGCATCCATTGT
GGTTAACAAAGTACTAAGCAGAATTAAAAAATTTGTTCATTTATTGGACATTACAACACT
TTCTCAATATAGAAAAGATGCACATCCAACTTCTTATAGTGATCACAATACTTTAGATTG
TAGCCATTGGTGTCTCCCTGGATTGCCTGATACTTGGAACCTCCTTCTCTATACATCACT
CATTAGTTGAAGACGAAAATACGACCGGATTTTATGTTTTCTATAACAACACCTTGTTGT
AACAGCCAAAACATATCTGAACAGATGGTGTTGTTATAGAGAGGTTTGATTGTGGTGAAT
GATTTTCAATTGTAAGGTGATTTTGTGTTTAGGAATTTGTTTGACTTTAAATTGTCATTT
GATAATAGTCAACAAAATAAGAATGGTTAGTGAGTGTTGAAGTGTAATATAGAAAAAAAA
TGTGATTTTTAGGCATGAGAGGATGCCTTAATTAGTTGAATTTGATGAGGCATATTGCCT
TTGAATTTGTACTTAATTTCTGTTGATTCAATTGATGTTGTAAGATTATTTTTTATTATA
ATAATTTAAAAGTGAAA