Microarray Probes on PGSC0003DMT400052202

Probe IDChipProbe Sequence
CUST_986_PI426222305 JHI_St_60k_v1 CAAATTGAGAGACATGGATGACGAGTATGCTAAGCTTATCAGGAGGATGAATCCTCCCAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400052202

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400052202 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG) Solyc02g094300.2 +2 0.0 657 336/341 (99%) genomic_reference:SL2.50ch02 gene_region:49450155-49452911 transcript_region:SL2.50ch02:49450155..49452911+ go_terms:GO:0008152 functional_description:Uridylyltransferase PII (AHRD V1 *--- C7JBQ7_ACEP3); contains Interpro domain(s) IPR002912 Amino acid-binding ACT
TAIR PP10 AT3G01990.1 +2 0.0 538 294/436 (67%) ACT domain repeat 6 | chr3:330256-332066 FORWARD LENGTH=433

Transcript Sequence (2011 bp)

>PGSC0003DMT400052202 2011 pgsc_dm_v3.4
ATTTAGTAGTTAGTGTGAATAGTGGTGCGGCGTGTTGTTTTTTTGATACGATAATAAAAT
TGGAAATATGGATGCCTTTTCCACTCATTAAAGCGTCACTTTACTCGTCTTCAGCTTTTG
CCTTTCTTCCACAGACATTGGAGACTCATTCTACTTTTAACCCTTACTTCTCTCCTCCCA
TATCTTCTTCTTCATTCATCCTACTATTCTTCTTTCCAAATTGAGAGACATGGATGACGA
GTATGCTAAGCTTATCAGGAGGATGAATCCTCCCAGAGTGGTGATTGACAATGACTCTTG
TGAGAATGCAACCATTATCCAGGTTGACAGTGTCAACAAGCATGGGATTCTTCTTCAAGT
TGTGCAGGTTCTGACGGATTTAAACCTTGTTATCACGAAAGCATACATTTCCTCTGATGG
GGGATGGTTTATGGACGTGTTTAATGTGACTGATCAAGATGGAAATAAAGTTAGAGATGA
AGAAATCATCAGCTATATCCAAAAGACTCTTGAAAATGACGAGGTTCTGTTACCCTCTTT
AAGGGGAACTGTTGGCTTGATGCCTTCTGAAGAGCACACGTCCATTGAACTTAGCGGGAC
AGACAGACCTGGCTTATTGTCTGAAGTGTGCGCTGTTCTTGCTGACCTTCACTGTAATGT
GGTGAACGCTGCAATCTGGACACATAATGCTAGGGCTGCAGCTGTGGTTCATGTTGTGGA
CGACATTACAGATTGTGCAATTGAAGACCCAAAACGCCTTGCTACAATCAAGAAACTTCT
TCGTAACGTCCTCAAGGGTAACAATGATTTGAAGACTGCAAAGATGACACTTTCACCTCC
TGGATTTACACACAGGGAGAGAAGATTACACCAGATAATGTTTGATGATAGGGACTATGT
AAAAGTTAGAAAGACAGAACAGGGCAACATTGAGGATTTGAAGTCCGGGCCTTGTATAAC
TGTTTATTATTGCAGTGAAAAGGATTATACTGTGATCACTATGAGGTCAAGGGATCGACC
TAAGCTGTTGTTTGATATTGTCTGCACTTTGACTGACATGCAGTATGTGGTCTTTCATGG
AGTTGTTCACACAGGAAAGAACGAAGCTTATCAGGAATTCTACATTCGACATGTTGATGG
GCTTCCAATAAGCTCAGAGGCTGAGCGAGAACGTGTGATTCTGTGTCTTGAAGCAGCTAT
TGAGAGAAGAACCTCTGAGGGTCTGGAGCTAGAATTGTGTACAGAAGATCGGCTAGGACT
ACTATCAGATATCACTAGGATATTCAGGGAAAATAGTTTGTGTATTAAAAGAGCAGAAAT
CTCAACACAAGGGGGGAAGGCAAAAGATATCTTTTATGTCACAGATGTGACTGGGAATCC
AGTTGAGCAAAAGACAGTTGATTCAATTTGTGAGCAAGTTGGCCCAAATATGCTGCATGT
TAAGTGGAATCCTTGTCATTCAGAAAAGCTACCTGAAGAAGGAACAATTAGCTACCTCTT
TGGGAGTCTCTTCAAAGTTCGAACCCTCCAAAGTCTGAAGCTGATTGGATCCTACACTTG
AGTGGTTCCCTGTAAGACTGGAAAACATTGTAGATATGTCAGATACACCACTCACAGTAT
GCGGATTTCAAGTAACAAAAATTGTAGATAGATATCCTACCCATTGGTGAAGAACTGTTT
AGTTTTATGTAAATAGTAACCATTAGATAGTTAGACCATATAGTGGTGATTTAGTATCAA
GAGATATAGAAGAGACTCTTAAAGCATCAGTAGTAGCAGATATTGCCAGGGGTTGTCTGT
ATATACATGGATGTGTGATATAAGTGGCATGTGCTCTGGACAGTGTTCACTATAAAAAGG
AAGAACCAAACTGTATAATAGAATATCACTTGTACAAATATTTATTTTATACTGTAAAGA
AAACAAAAGGTTTAGTGTGGGTTTAGATCAAAATGAAAAATTCCTCAGTCCCTTCCTTCT
CCTAACGTTTCCTTTTTTCCGTATAGTCTGC