Microarray Probes on PGSC0003DMT400052105

Probe IDChipProbe Sequence
CUST_1368_PI426222305 JHI_St_60k_v1 GAGCTAGCTAGGTAGCTAGTATATTGAAATAATTGGACAGGGTTAGGTTGCAACTAAAGT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400052105

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400052105 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG) Solyc02g093890.1 +3 3e-147 437 246/285 (86%) evidence_code:10F0H1E0IEG genomic_reference:SL2.50ch02 gene_region:49173963-49174790 transcript_region:SL2.50ch02:49173963..49174790- functional_description:Unknown Protein (AHRD V1)
TAIR PP10 AT3G27250.1 +3 9e-42 155 114/287 (40%) unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G40800.1); Has 104 Blast hits to 104 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 104; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr3:10061633-10062481 FORWARD LENGTH=282

Transcript Sequence (2451 bp)

>PGSC0003DMT400052105 2451 pgsc_dm_v3.4
CGTCTAATTAATGGAACCTCCCAGAAAAAAAGCATTCCCACTTTGCTTCTATCAAGGTAC
AAACGTGTCTACCTTTTTTTCCTCAGTGCTCACTCTACGTGACCTCACCTTATTGGCTCT
CACTGCAACACCAATCACAGCAACTCTATTTTCATTTTCCCTGGATACATGGGACCCACT
TGATCTCACCTCACCAATCACATCTCATCACTGTTTTAAGTTTAGCCCTAGACACGTGTT
GCTTCCTAACCCTACGAACTAACTGTGCCTGTAACTATGATAATCCTCTCGGCATCCGGC
AAAACTAAATTATTTCTATCTAAAAACCGCTCTACAACACACCCCGAATGGACCTTGCAA
ATACTTGGGCCGGGCCGGGATGCACAGGTACTCCCAAAGATACCACGATAATCAACCAGA
TGATGCTCAGGTTCCGGCCTATTGCGCCCAAGCCCGTAGCTAATTCTTCGGGCCCGGGCT
CTACGCCGGAAACTCTTGTTGTTGGAAAAAGAAGAACAAAGAGAAAGTACGTTAGAGTTA
AGAAAAATAACCAGTGCAAGATTAATAAAAAAGAAAAAAGTGATGGATCATCGGATGATC
ATCAAACTGCTGTAACTCTTCAGCTGCTGCCGGAAAGTAGTGGAGGAGTTAAAAGTTTGC
CGGAGAACAGATCTTACCCAAAAACTATCAACTTTTTGGTGCAAGACCGATCAATATGGA
TAAATAACAATATTTTATCTATCGGTGCACCGGATCCGTCAGTAGAGATCCGATCTCCGA
TGGTTGTGGAATCATGGGTGATGGTGGACGGTTTAACAAACACTACTTTGGTAGATTTAT
CAGCTTTAGGAAGTACGGACATGGAGAAGATGATGAATCTACAGCGTGACACGTGTCCGG
GGTTCATATCGGACGGTTTAGATAGCGTGAAGTGGGTGAATCTGGCGTATCGGAGGATGA
TAGATCCGGTAGAGGACGGAGGAGAACCGCCGGAGATGGCGGTGCGTTTAGTAGTGAAGG
AGAATAAAAGTGCAGCATTATTATTATTGCCAAGTTTTGCATGCATAGTAAGAATTGTGT
ATACGTGGAATAAAGTGAAGCAGTCAAGGACAATGCCTTGTGATGTATGGAAGATGGACT
TTGGGGGATTTGCATGGAAATTTGATGCTAAGGCTGCACTTAGCTTGGGCCGTTGAAGGG
TAAATAAACCCGACAATAGTAATTCAATCTAAGGTAATGTCATTTTTATATATTTAAATC
TCATGAGAACTGATGATATCATGAAGTCCTAAGTGAAAAAAATAATGATCCCTAAGGTTT
GTGAAATCTAGCTAGGGCAAAAATGATGCGTAGCTCTCCTTATTCAAAACTCGACTTCTA
AATGTGAAAAATGTTTGCTGGAAATTGATAATTGTGAAATTCATAACAAACTCTTATGTC
TTGTTATTCAGCTTTAATTTGATACATGAACTAGTACTTATTGTTGAACAAGGAAAGAGA
TTCATACTTGAAGGAGCTTAACTAAATGAAAACACTCCTTGGAACTAAGACCTAATTATT
TAACCTGTAATATTACTTAATTTACTTATTCGAACACAGAATAGTATTCCTAAACAACAT
AAATTTTCATTTGGTATCCCATTATATATCATGTCATTTCCAACATTTCATTTATTTTGA
AATGTTTTCAGGTCTTGATAGAATTTTTTCATACTCTACAATTTTTGAAATTTGTATTCT
GAATCCTTAAATATTTTCCATAAAGGACTGCACTGCATCCCCCACCCAGACATTGCATTT
GCTTTTTTATGTCAAATATATGTATTGACTACCAAATACCTACAACAACAAAATTTAGAA
AGGAGAGTAGACATGTACCAAATTAAAATGGATTTTTTTTTATATATGCTAGAGAAAATC
TACCGTGAGTGTATACAACAATAATGTGAATTAAGCTCTTCTCTTATGGGCCTTTGCACA
CTAGATGTATCTAAAGAGGAAATTTTCTACTCTATTATTCTCGAAAAGAATAAGCATTAT
TCTCCACATTATCTTGTAGTTGGTTCAAAATAATCGTCTGGCCAACTTTTTGGTCAAAGA
AAAATAGACAGTAAAGCACAATATTCATTGGATAGCTAGATCACATGATAAACATTGACG
TCTTGAATATTGAATATTCTTCATATTTTCTGTATTGTATAGTTTATTTTATTTTATTTG
TTATCGATCCTTTCACATACTACTAGATAGGAACTATGACTGAAGATAACTACTAAAGTA
ACTTATTGTTTTTAATTAGTGGAGCTAGCTAGGTAGCTAGTATATTGAAATAATTGGACA
GGGTTAGGTTGCAACTAAAGTAAATAATCACATTGTTATATTGCTTTATTGAAACTAGAG
ACTATATAACATCACTTCACCAAAAAGGAATGCTTTTGGTGTAATTCCAAC