Microarray Probes on PGSC0003DMT400052060

Probe IDChipProbe Sequence
CUST_958_PI426222305 JHI_St_60k_v1 AATCAGAAGCAAATTGCCAGATTGGGTGTCGCTAAGGACTTGGGCGATAGTGTTGGATTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400052060

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400052060 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG) Solyc02g094190.2 +3 0.0 1081 579/591 (98%) genomic_reference:SL2.50ch02 gene_region:49368076-49371114 transcript_region:SL2.50ch02:49368076..49371114- functional_description:Nodulin family protein (AHRD V1 ***- D7M603_ARALY); contains Interpro domain(s) IPR010658 Nodulin-like
TAIR PP10 AT3G01930.2 +3 0.0 825 440/591 (74%) Major facilitator superfamily protein | chr3:319289-321488 REVERSE LENGTH=584

Transcript Sequence (2354 bp)

>PGSC0003DMT400052060 2354 pgsc_dm_v3.4
TTATATCATACACTACCTAAAACAAAACATCATTGAATCAAAATATATATGGAGTAATTT
TTTCTAATCTCCGACCTCAGAGTTTTTAATTTGTTATTCATTACGGATGAAAAGGTGAAA
GATAGACAGACAGGTCCTTTGACTTCCCCCAAGAAAGATTTAGAATCTGAATTCTCAAAG
GCAATTTTGATCTAACAATGGTTCGTTTGAAAGAGAGATTCAGTTTGTTCTTCAATAACA
GATGGCTTGTATTCGTAGCTGCAATGTGGATTCAGAGTTTTGCTGGCATTGGGTATTTAT
TCGGCAGTATTTCTCCCATCATTAAGAGCTCTTTGAATTATAATCAGAAGCAAATTGCCA
GATTGGGTGTCGCTAAGGACTTGGGCGATAGTGTTGGATTTCTGGCTGGGACTTTATCCG
AAATCTTGCCTTTATGGGCTGCTCTTCTTGTGGGTGCTGTTCAGAACTTCATTGGTTATG
GCTGGGTTTGGCTCATCGTCACCGGCCGATCTCCTACTCTTCCTTTATGGGTTATGTGCC
TTCTTATATTTATAGGAACAAATGGAGAAACCTACTTTAATACAGCCGCACTTGTCTCAG
GTGTGCAAAATTTCCCTAAAAGCCGTGGCCCTGTGGTGGGAATACTGAAGGGATTTGCTG
GGTTGGGTGGTGCAATTATGACTCAAATATATGCACTGATCCATTCCCCCGATCATGCTT
CACTTATATTTATGATTGCTGTGGGACCGGCAATGGTGGCTATCGCCCTCATGTTTATAA
TCAGGCCTGTTGGTGGCCACAGACAAGTCAGACCATCTGACGGATTCAGTTTTTCATTAA
TTTACAGCATTTGCCTCATTTTGGCTTCTTACCTGATGGGCGTCATGCTTGTTCAAGACC
TCATTGATGTTAGCCACACAGTCACTACAATCTTCACAGGGATTTTGTTTGTTCTATTGC
TTATTCCTGTGGCGATTCCCATCTCATTGACTTTCTCGCAAGAAACTAGAGTACCATCAG
AAGAGGCTCTTTTATCTGAGTCACAAAAACAAGATCCTGGAGTATCTGGACATGATCAGG
AAATTATATTTAGTGAGGTTGAAGATGAGAAGCCTAAGGATGTAGACTTGCTTCCAGCAT
TAGAAAGGCAAAAAAGAATTGCCCAACTGCAAGCAAAACTAGCCCAAGCAGCTGCAGAGG
GAGCAGTGAGGGTCAAAAGAAGACGGACCCCTCATAGAGGGGAGGACTTTACCCTAATGC
AGGCTTTGATAAAGGCAGACTTTTGGATTATATTCTTCTCACTACTTTTTGGTTCTGGAT
CTGGTTTAACCGTGATTGATAACTTGGGCCAGATGAGCCAATCTTTAGGATATGATAACA
CACATGTATTTGTTTCCATGATCAGCATATGGAACTTCCTCGGTCGTGTTGGGGGTGGAT
ACTTTTCTGAAATAATTGTGAGAGATCATGCCTACCCAAGACATGCAGCCATGGCTGTTG
CCCAAGTTGTAATGGCTTTCGGGCATTTCTTCTTTGCCATGGGCTGGCCAGGGGCTATGT
ACATTGGTACTCTTCTGGTAGGGCTCGGTTATGGGGCTCATTGGGCTATCGTGCCAGCTG
CTGCTTCCGAATTGTTTGGCTTAAAGAATTTTGGGGCTTTGTACAATTTCCTCACTATTG
CGAACCCAGCTGGTTCACTAATATTCTCAGGTGTTATTGCTAGTAGTATATATGATAGTG
AAGCTGAAAAGCAAGCTCAACAGCGTCATCCCGGCCAATGGAATGGGGCATCTTTTTTAT
CAAGTTTTCTAGCTGTGGATGAACCTTTAAAGTGTGAAGGTGCCATATGCTTCTTCTATA
CTTCCTTAATACTTTGTGGACTCTGCATCGTTGCTTCTATTCTAAGCATGATTCTGGTTT
ACCGAACAAAGACTGTATACACTAGTCTTTACGGAAAATCTCGTACATAATTCATCCGGC
AAGTGAAAGCTTGGATAGAAGTTTGAGTAATTTGCACAGATACTTTCAACCAGCTTATGG
ATCTAAGAGCATTTCGTTGAGGTGACATTGTTAGCCATAACCAGAACACTTCCTCCAGAA
TGTGAGCAAGACAATGGAGATGGCAAAGCTGCCTTTTTTTGCTCTTAGAAGCTTTTCCTA
TTTATGTGAGATAAATGTTTGTATTGCAATTTTTGATTGGTGTATATTTCCATTGTCATT
CAAACTTGAAATTGTTACATTTTGGTTGTCAACCATTTCATTTATTGATTGTTCATTATT
TTTCTTTTGATCGTAAATGGCTTTACGCTGCACAATGTAGAGGTTCTAGTCCAGTGACAT
TGACAACTCGCTAT