Microarray Probes on PGSC0003DMT400051979

Probe IDChipProbe Sequence
CUST_25921_PI426222305 JHI_St_60k_v1 GGTTAGAGGTCCATTGAAAAAGTGTTGGTCCGCCAGTCATTGTAATCATAAAATGGAAAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400051979

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400051979 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G13020.3 +3 0.0 579 282/440 (64%) Protein kinase superfamily protein | chr4:7604015-7606812 FORWARD LENGTH=444

Transcript Sequence (2089 bp)

>PGSC0003DMT400051979 2089 pgsc_dm_v3.4
CAGCTGTCTCTGACTTCTCTGTAACTTCTTGACAGAGAAAACATAACTGAAGCTCAATGA
AAAGAGGCATGTTCATGGTTTGATATTTTGTTGGCTTACTTTATCCAAGATATAGCAAGT
ATTTGACAGAAACCAGTGGCTGCCTTTTAGATGATAACTACTGATTGCAGCTCGTGAAGG
CTGCATTTAAGCATGTTGATAGTCTTTCAATTGATTTTCAATTTCTTTTGTGATGAGAGG
TGGATTTTTTACCATTTACCGTATCGTATGCTGCACATAAAAAGTGATATATGTCAACAA
TCACGTGAAGATCACTGTTTCTACAGTGTAGAAACCTCTATCAGGAGGTTAGAGGTCCAT
TGAAAAAGTGTTGGTCCGCCAGTCATTGTAATCATAAAATGGAAAGATATAGAATATTGA
AGGAGCTTGGAGATGGAACGTGTGGTAATGTATATAAGGCCATTAATACAGAAACATCTG
AAATTGTTGCAGTAAAGAAAATGAAGAGGAAGTTCTATTTTTGGGAAGAATGCATTAATC
TACGTGAAATAAAGTCCCTCCGTAAATTGAATCATCCTAACATCATCAAACTGAAAGAGA
TTGTCAGGGAAAACAATGAGCTTTTCTTCATACTTGAGTACATGGAACGTAACTTGTACC
AACTAATGAAAGATCGGCAAAGACCTTTCCTAGAGGAAGAGATTCGAGGATTGATGTCTC
AGGTGTTGCAAGGACTTGCCCATATGCATAAAAATGGTTACTTTCATCGGGACTTGAAAC
CTGAGAATTTACTGGTGACGAATGACGTAATTAAAATTGCTGACTTTGGGTTGGCTCGTG
AAGTGTCTTCATTGCCTCCTTTCACTGACTATGTTTCAACTCGTTGGTACCGAGCACCAG
AAGTTTTGTTGCAATCTTCATCATACACACCTGCTATCGATATGTGGGCAGTTGGCGCGG
TACTTGCTGAGCTTTTCACTCTTTGCCCAATATTCCCTGGTGAAAGTGAAATTGATCAGT
TGTATAAGATATGCTGTGTTCTTGGACCACCAGATTGGACTAGCTTCCCAGAACTGAGAA
GTGCTTCACGGTTGTTTGATATAAGTTGTTTTGATATTACACCAGCCAATCTGTCTGATG
TCATTCCAAATGCTAGCTTGGAAGCTATTGATTTGATCAAGCAACTCTGCTCGTGGGACC
CATTGAGAAGACCAACTGCTGACCAATGCTTACAGCACCCATTTTTTCATGTTGATATGT
CAATTCCTCGTCCTCTAGGGGATCCACTGCAGATGAATTTAAGTAGTGTTGGACCTGAGC
CTAATCTTGAGTTGAACCTGTGGGATTTTGGGACAGAAAAAGATGACTGCTATCTTGGTT
TGACTTTGGCTGTGAACCCAACTCCCTCTTGCCTAGATTTATTTCCTGCAAAGATGGCAA
GTAAAAGTCAAGGTGCAGGAACGGATATGTTCTGCCCTGGTTTCCAAGATCACTCACAAC
ACTCAGTTTTCTGGTCATTGTTTCCTACTGATCACCATCAAATATCTACTCCGGTGGACT
CCTCATTGTCATTATCATTCAGCACGATTCCACACTCAACTATTGGAGCTCCACAATCAA
CTGGTTTTGGCATGACATCTCTGCAGACTAACTTCTTGGAGCGCCCCTTTCTGGCTATGT
CGTCATCCTTTCAGCAGGGACGTTGCCTTTGAGCTCCTGATTCAAGTCTCTAGTTCGACT
AAATAAGCAATTATACTAGTATTTAGTTGTAATCTGTAAATGTAGTTGACAGCACAATTA
AAGTCTATTTACTAGATTTTTTTCATAATTCTCAGAAGATTCTCTTCTAAAGATGTAGAG
TGACCCACACCCCTTTTAGGCGGTGTAGTTGGTGTCCTTGTGGGAACAATCGTATAGAAG
ATGACTGAAGTATACTGTTGTAATTATTAAACCATCATAAACGTGGAGAAAGATACAACT
CTAGTTCTTTATTTAGTTTTTGTTTTCATTGTTAGTTGGATGAGCTGATTGCCTGGCCTT
TTGGGGCCACAAAAGATTTGCTAGCTACTCTTGAATAACATCACTTCTT