Microarray Probes on PGSC0003DMT400051852

Probe IDChipProbe Sequence
CUST_25914_PI426222305 JHI_St_60k_v1 GGAAGAGGGATCATTTTTGTAGTTCAGCTTGTTGTTTACTTGAGAATATGAACTGAATCA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400051852

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400051852 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G63060.1 +3 1e-105 315 153/244 (63%) EID1-like 3 | chr3:23300638-23301456 REVERSE LENGTH=272

Transcript Sequence (1117 bp)

>PGSC0003DMT400051852 1117 pgsc_dm_v3.4
GTTTATTTAAGTTCCCAAAAAACTACTTTACTGACCACATTCTCGTCGGAAAAGTAAGTA
TGAGTGACAATCGGAGTCAAAGACGGCGGGTCGGAGAGTCGTCCGAATCGGGAATTTACA
ATGAGAGGATTCTTATCTTGGTGTTTGCGTCAATGAATTGGGATATTCGTACACTATGTC
AAACGGCGTCGGTCAATAGGAAACTCCGTGCAGTTGCGAGAAGGATTCTATGGAGAGAGC
TATGCGTGTATCGAGCTCCGCAAATGATAACGGCGTTAACTGACGGCTCTCCGAGCGGTA
GAATTGGCGGCGGATGGCAGGCGATGGCAAAATTGATGTTTTTCTGCAATGGATGTCAAT
CGACCCGGCATTTCCAAGTGCGCGAATCGCCATCGGGTCACTTCGTGAAAACATCTCGGT
TTTCGAAGACATCCGGTCGGAGTTTTTTGGTGAAGAAATGTAGAAGTGATTTGCTGTACG
TGAGTGATCCGTGTGAGCATCCAACTGGGAGCGATGATTTGGGGCTTTTCAGAGGGGTGT
TTTGGGGATTTATGAAATCTAGGACAAGGGCGAGTTTGATCAGAAGACGAGTGGAGCTTG
AAGAAGGAGCCAAGTGTCCATTCTGTCGAGCTCGGGTTTGGAGTATGACGGCGGCTCGGC
TCATACCCAAAAGTGCGGCGCGGCGGCTTGGTTCGATGGAGACTGGATTGGAGTACTTTG
TATGTGTTAATGGGCACTTATATGGTGCTTGTTGGCTGGTTCCTTTATCGTCTGATGAAG
GTGAAGAAAAAGATGGTGATGATGAAGATGAAGCTGAAGATAGCAGTGAAGAAGCTGACC
AGAGATTTGACGGCGGCGGCTATTTTCATCGTGGGAATCAGATAGTAATAAATGGGTGTC
TGAATTACGGGCTTACTTCTTGATATGACCAAAATGGAATCAAAAGGGACGGGAAGAAGG
GAAGAGGGATCATTTTTGTAGTTCAGCTTGTTGTTTACTTGAGAATATGAACTGAATCAA
AATTTTCTGTTTATTTGATGATTTGTTTAAGTTTCTATTCTTAAGAAAATCTTTTCTGTT
ACTACTAGATTTCCAGTGGAAAGATTTGTCACTTGAT