Microarray Probes on PGSC0003DMT400051832

Probe IDChipProbe Sequence
CUST_25787_PI426222305 JHI_St_60k_v1 TATACTGTTAGTTAGTTTCTTGATATTTTTGTTTTTGGTAACAGAAGGGGCACCTCAGAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400051832

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400051832 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G12910.1 +2 0.0 711 327/474 (69%) serine carboxypeptidase-like 20 | chr4:7550576-7553051 REVERSE LENGTH=497

Transcript Sequence (1845 bp)

>PGSC0003DMT400051832 1845 pgsc_dm_v3.4
CTACAGTTTACTTTAGCTATAAAAACCCATCAAAGAATTCAGAATTTTGATATTACCAAA
CATGGCAAAAAAAAACTTTGTTTTACACTATAATATACTGTTAGTTAGTTTCTTGATATT
TTTGTTTTTGGTAACAGAAGGGGCACCTCAGAGTGCACTGGTAACTCAACTCCCTGGATT
CAATGGCACTTTTCACTCAAAACATTATGCTGGGTATGTTAATATAGATGAAAGTCATGG
CAAGAATTTGTATTACTACTTTATTGAATCTGAACGAAATCCATCAAAGGATCCAGTTGT
TCTTTGGCTTAATGGTGGACCTGGCTGTTCAAGCTTCGATGGCTTTGTCTATGAGCATGG
GCCTTTTAATTTTGATTTTGGAAAGCCAAGTGGTAGCCTGCCTTCTCTGCATAACAATCC
ATACAGTTGGTCAAAGGTTTCCAATATAATATATCTGGACTCTCCTGTTGGTGTTGGATT
GTCTTACTCGGGAAATAAATCTGACTATGTGACAGGAGACTTAAAGACTGCATCTGATAG
CCACTCATTTCTCCTCAAGTGGTTTGAGATCTATCCGGAGTTCCTCACGAACCCATTTTA
CATATCTGGAGAGTCTTATGCTGGAATATACGTGCCAACTCTGGCTTCTGAAGTAGTAAA
AGGTATTGATGCTGGAGTAAAGCCTGCTATCAACTTTAAGGGTTACATGGTGGGAAATGG
TGTGACAGATGACAAAACAGACGGTAATGCTCTTATTGGATTTCAACATGGTATGGGCCT
CATTTCAGATCAATTATTCGAGGAAGTTAATGCTGCATGCAATGGAAATTTCTACGAACC
ATCGCTAGAGGAATGTATAAAGTTGTTTCAGAAAATTGATCTGGTACTTAGTGATATAAA
CATCTATGACATTCTAGAACCATGTTACCACAGCAAGGAACCTAGTTTAATTACCACTAA
TAGCTCAAGATTGCCTATGAGCTTTCGTAAACTAGGTGAGACAGAAAGGCCTCTTCCTGT
CAGAAAAAGAATGTTTGGCCGCGCATGGCCTTTTAAAGCTCCAGTAAAAGAGGGACGTGT
CCCAACTTGGCCGGAGATTCTCAATGGTGTAGCAGTCCCTTGCACTGATGATCGTGTTGC
TACTCTGTGGCTCAACAATGCAGATGTTCGTAAAGCTATTCATGCAGAACAAACAACAGT
GATAGGTCCCTGGGAGCTATGCACAGACAAAATAACCATGTATCATGATTCTGGAAGCAT
GATTCCGTATCACAAAAATCTCACAGCTCGGGGCTATCGGGCAATCATATACAGTGGGGA
TCACGATATGTGTGTACCATACACTGGTTCAGCACTATGGACAAGATCACTTGGATATCC
GATTGTTGATGAATGGAGGCCTTGGTATGTGAATGAACAAGTTGCAGGTTTCATTCAAGG
TTATGACAACAACCTCATTTTTATGACTGTTAAGGGAGCTGGACACACCGTGCCAGAGTA
CAAACCACGAGAGGCGTTGGCGTTCTACGCCCGCTGGCTAGAGGGCAAGAAGATATGATA
ATATGAATAATGAAGGCTGAATTAGTAGACGTTGTTAAGTCCAATTATTTCTGAGATTTT
TCTATGACTCTTAACAGGAGAATAATAGGGAGAAGAAGGATATTGGATTTTTATCATGTA
TTGATGTCTGCAATAAGAATTAGTATTTGTATGTTATCCAATGTACGTTGTGACTGTTAT
GGCATGCTTATATTAACTTGCTTTGAATCGAGGATTTATTGGAAACAACATCACTATCCC
ATAAAAAGTAAGGGTAAGATCAATCTGTTGTATTTTATCCTTCTC