Microarray Probes on PGSC0003DMT400051630

Probe IDChipProbe Sequence
CUST_25955_PI426222305 JHI_St_60k_v1 CAATCGATCAAAGTTCAGAAGCTGGCAAGTCTCAAGTGGATGTTGACCCTCCCCAAAAAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400051630

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400051630 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G52420.1 +1 2e-06 44 21/38 (55%) outer envelope membrane protein 7 | chr3:19429775-19429969 FORWARD LENGTH=64

Transcript Sequence (489 bp)

>PGSC0003DMT400051630 489 pgsc_dm_v3.4
TGAAACTTTTCCGTAATTGGAGGGCCCAATGGGAGGTTGGTTCTATATCTTAATTCCTCT
TCTGGTCACAGTATAAGTAGAGTAGCAAACTAAACCCTCATCGGCACGTCGCTGCTTGTG
ATCTCAATGGCGAAGAATAACAACTCGTTGAAATCAACCGCAGTGGTATTCGGAGCCCTA
GCATTTGGGTGGCTGGCGATTGAGCTTGCTTTCAAACCGTGGCTTGATAAGGCCCGAGCC
TCCATGGATAAGTCTGACCCATCTCATGACCCCGACGATGACACAATCGATCAAAGTTCA
GAAGCTGGCAAGTCTCAAGTGGATGTTGACCCTCCCCAAAAAAACAACTAATTTAAGAGT
TCGGTTTGATATTTATTTGGGTTCTAAACCCCAAAATCCAAATACATATGCTTGAATTTA
CTTGGTAATAAATAATCTATGAATGTTAATTTCTGTTCTTCAGTTTCTAGCCATCAAATT
ATGACCCTG