Microarray Probes on PGSC0003DMT400051115

Probe IDChipProbe Sequence
CUST_45072_PI426222305 JHI_St_60k_v1 CAGAACTTGGAAGGAAAACATTTCAGTGTGATAACTCGTACAAATTCGTGTAATTGCATT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400051115

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400051115 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G14030.1 +3 1e-40 146 82/150 (55%) translocon-associated protein beta (TRAPB) family protein | chr5:4526878-4528253 FORWARD LENGTH=195

Transcript Sequence (1581 bp)

>PGSC0003DMT400051115 1581 pgsc_dm_v3.4
CACGTTTATATAATTTTCCATATTCATCTCCTCCAAAACATTTCCTAATGGCGACAGCAC
CATTGATAATCTTCACCATTTTTGCTCTTTTTGGAGTTTCCTCTTTAACTGCGGCAGCAG
AAACTCCGTTTGTGGTGGCTCACAAGAAGGCTTCACTCCTAAAACTCAAATCCGGTACCG
AACGGGTCTCCGTTTCCATTGACGTCTATAATCATGGATCTCTTGCTATATATGATGTAA
ATCTTACTGATGATAGCTGGTCCACAGAAATATTTGATTTCGTGGCTGGAAACACGTCCA
ATTCATGGGAAAAACTTGATGCTGGCTCTCATGTTTCACACACTTTTGAGTTGGAATCCA
AAGTGCAAACAACTTACTATAGTGCACCTGCTGTCATAACCTATCGCATCCCTACAAATT
CAAAACTACAGGTAGCATATTCCACCCCTGTTCCTGCACTAGAAACCTTAGCAGAAAAAA
CTGTTACCTACAAATTACATTTGGTAACTTTGCCCTCCTAACACAAGCATGAGATATGGT
TTCCTTATAATTGTTTTGTAAACATTTCTTGCTGTTCTGACTAAAGATTGTTTCTTCTTT
TACCAATCGGGCTGTTTTGGACTGGCTGGTCACTCTCAGGCAAAGGTAACTTGAGACCTC
TTCTTTATTCTATTCCATTTGTTCACTAATCAAAATCTCTCATCAGTTTCACGGGCACGA
AACAGAAAAAGCAAGTAAGGTTCTAATAAGTACCTTCCTGTTAGTTTGTAAGGGGAAGTT
GTTTCAGAAATTGATGTATATATGCTAGCAATTAAATTTACCTTATTCCTAAAACGAAAT
ATAGACATTGGTATAACAGGAGGCTGGGAGACCTCGAGCGTAATATACGCTACCATCGGA
GAGACTTTAGCCACATCTTAATCTGAATGAGGTGATCAAGAAAGTCCTCCCCTGGAAAAA
AAAATATACATCAATTACCTGTGCCCGGTCTATGGTCTAGTGGTAAGAGCACATCACGTT
ATGTGTGGTTAGGCATATGTCATGTGTTTGAACACTGCCGGAAACAAAAGTTTTGTATTT
AAATAGAGCAGAGTAGAGAGGCAGGCCCATTATCTAGCGAGTTTCAAATTGTGTGTCACA
ATCTCAAAGATTTCTCGGTTAATATTTTGTTTGCCAAGTTGATGTGAAAATCTCTTTTTA
ATGGTAGTTGTTTTCTTTGTGCAGAAGTTGCTTGCACAGTATGGATCCCATTTTTCTTTA
GGTCTCATCGTCTATTTGTTCGTGCGAATTATATTTAGTCCATCAGCTAAATCAAGTGCT
GGAAACGCAAAGAAAAGACACTGATCGTTCATCAGCTGTAGCAAACTTCTCTTTTGTAGA
GGCAAGGCCTCATACCTGATACAGAACTTGGAAGGAAAACATTTCAGTGTGATAACTCGT
ACAAATTCGTGTAATTGCATTTTGTTGAACTGAAATGTATTGGATGATTTCACTTGGGCT
ATATGAAATTTTCTAAATGTCTTGCTAAAAATATTTAAGTTACTTTAATTACATGTAAAT
CTTATTGAGATGCCTAATCAA