Microarray Probes on PGSC0003DMT400050473

Probe IDChipProbe Sequence
CUST_38421_PI426222305 JHI_St_60k_v1 TTGATGTGCAGCGGCAACTGGAGCTGGATTCATTGCAAGAGACATTACATTTCAGAACTG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400050473

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400050473 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G49220.1 +1 1e-143 422 195/231 (84%) Plant invertase/pectin methylesterase inhibitor superfamily | chr3:18249840-18253647 FORWARD LENGTH=598

Transcript Sequence (993 bp)

>PGSC0003DMT400050473 993 pgsc_dm_v3.4
GAAAAGTACTCTGTTATCATCTCTGTAACATTGGATCATGGCCTCACAGTGCAACTTTCT
TGATGTGCAGCGGCAACTGGAGCTGGATTCATTGCAAGAGACATTACATTTCAGAACTGG
GCTGGGCCAGGCAAGCATCAAGCGGTAGCTCTTCGTATTGGTGCTGATCATGCTGTGATT
TATCGATGCAACATCATCGGATACCAAGACACTCTGTACGTGCACTCCCAGCGCCAATTC
TATCGCGAGTGTGATATCTATGGGACAGTTGATTTCATCTTCGGTAATGCAGCAGTGGTC
ATCCAAAACTGCAGCATTTATGCTCGAAAGCCAATGGACTTTCAAAAGAACACCATCACA
GCTCAAAACAGGAAAGATCCCAATCAAAACACTGGCATTTCAATCCATGCTTGCAAAATC
ATAGCCACATCTGACCTCCAGGCATCTAAAGGGAGTTTCCCCACGTATCTAGGGCGACCA
TGGAAGCTGTACTCACGAACTGTTGTCATGTTATCTTACTTGGGTGATCACATACACCCG
CATGGTTGGTTAGAGTGGAATGCTACTTTTGCTCTTGATACATTGTATTATGGTGAGTAT
ATGAATTATGGGCCGGGAGCAGCCGTGGGGCAACGGGTAAAATGGCCGGGATATCATGTG
ATCAATTCCACGGATGAGGCCAGCAAGTTCACTGTAGCTCAATTCATTTTCGGATCATCG
TGGTTGCCTTCAACTGGGGTGGCATTCTTGGCAGGTTTGAGTACCTGAATAAGTTAATGG
TATAAATGAACATATTTTCAAGATGGAATTTTATGTTTTGTGCAGTAATATATGATGAAT
AACATGGAATGTCCCATTAATAGTATTTCCATTATTGGTGATCTGACCGAAGAAACATTC
CAGATTACAGCTTTCATTGTTTAGTAAGTGCATGTAATTTGTTTTTCTTTTTTTTTGTTG
TTATTAATAGATCATATATATACTAGATTACAG