Microarray Probes on PGSC0003DMT400050270

Probe IDChipProbe Sequence
CUST_45797_PI426222305 JHI_St_60k_v1 TAACCTGCCGGTGTGGATCTCAATTTTGCTATATATGTGGAGAAACATGGAGCGAAAGCC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400050270

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400050270 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G14250.1 +3 6e-64 210 98/268 (37%) RING/U-box superfamily protein | chr3:4745963-4746958 REVERSE LENGTH=303

Transcript Sequence (1211 bp)

>PGSC0003DMT400050270 1211 pgsc_dm_v3.4
TTCGCATTGTTATCCAATTCAATAATAGAACACTATAAAACCCCTTTGCATACATCAAAA
TCAAATCAAGTAGTATCACAAATCTGCAAAGTTCTCCAAGAAATCTTCAAACTAACTAAC
CACTGATCAATTCAATGGCAGACATAATATCAAATGTGTTTAATGAAAACGATGAGTTTC
GCGCTCTCATACTATCAGACAAGGAGTGCGCGGAGGAACTGCAATACCAAGAGGTTCTTG
CAGCCTCTTTAGAAATCTTCCATCTTCACATGTCATCAACACAAATCGAAGAATCCCCTG
AATCATCCCAAGGTTTTTGTGACATTTGTATGGAGACAAAAGTTACAAATGAAATGTTCA
AACTCGAAAATTGCTCTGATCACTCATTCTGTACTGATTGCCTAGCCCAATATATCCAGT
CCATGATTCAAGACCATATTTTCTCAGTAACTTGCCCTGGTTTGAAATGTTGCGCGACAA
TTGAACCTGTTTCTTGTAAATCCATCATCCCAGAAAATGTATTCGAAAAATGGGAAGGGG
GATTGAGTGAGTCTGCTCTTCTTGATTGCGAAAAATTCTATTGTCCTTACAAAGATTGTT
CAGAGCTGCTGATTTATGATCATGATCAGGACATAATTGAGTGCGTATGTCCTGTATGCC
ACAGGCTGCTCTGCGCGGCGTGTGGCGTCCCTTGGCATACTGGATTTGATTGTGACAAGT
TTCAAAATGATGAAAAAAACAGAGAAGATGATTTAAAAGTTGAGGAACTTGCTAGCAGCT
CCAAATGGATGAAATGCCCTCACTGCAAACATATTGTGCAGAAAGCTGATGGTTGTATAC
ACATAACCTGCCGGTGTGGATCTCAATTTTGCTATATATGTGGAGAAACATGGAGCGAAA
GCCATTGGAGTTGTCAAATTAGTGAATGATACCGGATTGCTTCTAAAGAACTGGGAAGAT
TGAAAGAAGGGTAAATTATGCTAAGTGGCCATTCGGCCCTTTGCGACCAAAATTAGCAAA
AAAATGTTGTTCCGTCCTTCTTCAACTTTCGACTTTGAATGTATTATAATGTTTAGTCAT
TGTAAACATAAGTTTGTATTGTATACTTTTTATGACTTTCGGCAAGTTAAATTGTATAGT
CAGTGTACATTTCCTATAATTTTTTAGTATTTTTATTTAATGTAAATAAAGCATGATAAT
ATTTATTGTAA