Microarray Probes on PGSC0003DMT400050261

Probe IDChipProbe Sequence
CUST_45820_PI426222305 JHI_St_60k_v1 CTGTTAGCCTTTGATTGTATGAGATCAGGTTGGTTGGCTTACTAATCTTTTATTGTGTTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400050261

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400050261 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G61430.1 +3 6e-109 334 193/358 (54%) NAC domain containing protein 100 | chr5:24701328-24702553 REVERSE LENGTH=336

Transcript Sequence (1798 bp)

>PGSC0003DMT400050261 1798 pgsc_dm_v3.4
ATTAAGAGTTTTTATTATAAGAGAACAAGGGCCTAAAACAATAGTTCCTTAGAGCTCACG
TTTCTCTCCATCTCCTTCAAAGACCACTATTTATGCCCTTCTTCTAATCATTTCTCTGAT
TTTCTCTCCAACTTTCTCATTAACTTTTCTTCTTGATTCTGAAAGACCAAAGATATCATT
TTTAAAGACTTTATATTAGTTCTTGAATCTTGATTTAGTATTATTTCTTTGTTGTTTTTT
TGAACTGTTAGGTAACGACCTGATTATTTTTTAAAAAATCATAAATTTTACAAAAGGGTG
TTTAGGTTGTTTTGATGATGGAGAATTTTTCTGGAACTGTTAAAATGGATGATCAACAGC
AGCAGCAGATGGAACTTCCTCCGGGATTTCGCTTTCATCCTACTGATGAAGAGCTAATTA
CTCATTATTTGTCTAAGAAAGTTGTTGATATGAATTTCTCTGCTATTGCTATTGGAGATG
TTGACATGAACAAAATTGAACCTTGGGAGCTTCCATGGAAGGCGAAAATTGGGGAAAAAG
AATGGTACTTTTTTTGTGTGAGAGACAAGAAGTATCCAACTGGTTTGAGGACAAACAGGG
CAACTGCTGCAGGTTATTGGAAAGCTACAGGAAAAGACAAGGAGATTTTTAGAGGAAGAT
CTCTTGTTGGGATGAAGAAAACTTTAGTTTTTTACAAAGGGAGAGCTCCAAGAGGTGAAA
AAACAAATTGGGTAACTCATGAATACAGATTAGAAGGAAGATTATCACTTAACAATCTTC
CTAAAACAGTAAAGGTACAAACTTTATGCATTAATCCTCTGTTTTATCCCCTGTTTGATT
TCAAGATTCCTAATTGATGTTTTTTTACTATTGCACAGAATGATTGGGTGATTTGCAGAG
TCTTTCAAAAGACAACTGGTGGTAAGAAAATTCACATTTCAGGGCTTGTGAGAGGGAATT
CTGATGAAAATGAAATTGTCAATTCCGTTTTGCCACCATTGACAGATTCATCGCCAAGTC
ACGTGCACTGCTTCTCCAATTATGTTACTACTCAAAAGAATCAAGAAAATAACATGATCA
ATTCCTTCAACAATTCTCCTAATTTCCCTCTTCTCTCGAATTCCATTGACATTTTTCAAA
GAAACTCTCTTCCAAATTCGTTCACCTGGAACCAAAATGTCCCTCTTCAACACAATTTTC
CACAGCCAGGTTCATTTCCTATACAAGATCCTGCAACTCTGAGGAATTTGCTTGAAAATT
ACGGACAGAACATTCAACATCAGAGTTTCAAAAAGGAGACAGATATGATCACTGTATCCC
AAGAAACAGGTATAAGCACTGATATGAACACTGAAATTACATCAGCTCAACAGGATCTTG
ATTGCTTCTGGACTTACTGAAATTCTTCGCAGAAAAAAAAAAAAAGGCAAAAAGAAGAAC
AAACATAGAGCTTCAGTAGTAGTAATAGCTATTATGGTGTGAAATTAATTGTTATATGTA
TAGATTTACTAATCCCCTAAGTTGCATTCAACAATAGTAACCATATTATGGCCCAGAAAC
TATACTCCTACCACAATTTTATTTTATTTTGTTGTCATTTTACACTTCCCATTTGTCTCA
CTGCCGCGATTAGTTATTGTAATATTGAATTTGTAAAAAAAAAAACTAGTGGTACTTTGA
ACACTGTTAGCCTTTGATTGTATGAGATCAGGTTGGTTGGCTTACTAATCTTTTATTGTG
TTTTTTTCCCTTTGAAACTACTTTCTTGTCTATGGATCTCATGAAGATAAGCTCTAGC